Hostname: page-component-586b7cd67f-t7czq Total loading time: 0 Render date: 2024-11-22T06:36:09.379Z Has data issue: false hasContentIssue false
  • English
  • Français

Confirmation of hilsa shad (Tenualosa ilisha) in Vietnamese waters: a morphological and genetic analysis

Published online by Cambridge University Press:  11 April 2024

Vanthu Giap Open the ORCID record for Vanthu Giap [Opens in a new window] ,
Md Rashedur Rahman  and
Chenhong Li
Vanthu Giap
Affiliation:
Shanghai University Key Laboratory of Marine Animal Taxonomy and Evolution, Shanghai Ocean University, Shanghai 201306, China Engineering Research Center of Environmental DNA and Ecological Water Health Assessment, Shanghai Ocean University, Shanghai 201306, China Institute of Aquaculture, Nha Trang University, Nha Trang, Vietnam
Md Rashedur Rahman
Affiliation:
Shanghai University Key Laboratory of Marine Animal Taxonomy and Evolution, Shanghai Ocean University, Shanghai 201306, China Engineering Research Center of Environmental DNA and Ecological Water Health Assessment, Shanghai Ocean University, Shanghai 201306, China
Chenhong Li*
Affiliation:
Shanghai University Key Laboratory of Marine Animal Taxonomy and Evolution, Shanghai Ocean University, Shanghai 201306, China Engineering Research Center of Environmental DNA and Ecological Water Health Assessment, Shanghai Ocean University, Shanghai 201306, China
*
Corresponding author: Chenhong Li; Email: [email protected]
Rights & Permissions [Opens in a new window]

Abstract

One specimen of tropical shad was caught from the Giang Thanh River, Kien Giang province, Vietnam in a survey on 16 October 2022. We identified the specimen as the hilsa shad, Tenualosa ilisha Hamilton, 1822 using morphological analysis, and further validated by its cytochrome oxidase subunit I (COI) sequence. The specimen was 418 mm long, 1428 g in weight, with a head length of 29.0% and pectoral fin length of 31.1% of its standard length. Notably, the presence of 34 scutes, a higher gill raker count and a caudal fin length within the moderate range for Tenualosa species distinguished it from T. macrura, T. toli and T. reevesii. The COI sequence of the sample matched closely to the T. ilisha. The results confirm that T. ilisha still endures Vietnamese water, where it was thought to be extinct. Climate change and Indo-Pacific Ocean currents may introduce expansion of distribution area of the T. ilisha. Further studies on distribution of the T. ilisha and other Tenualosa species and their dynamics are needed.

Keywords

distributiongenetic identificationhilsaTenualosaVietnam
Type
Marine Record
Information
Journal of the Marine Biological Association of the United Kingdom , Volume 104 , 2024 , e42
Copyright
Copyright © The Author(s), 2024. Published by Cambridge University Press on behalf of Marine Biological Association of the United Kingdom

Introduction

The aquatic ecosystems of Southeast Asia harbour a rich biodiversity (Koh and Sodhi, Reference Koh and Sodhi2010; Liu, Reference Liu2013; Hughes, Reference Hughes2017), with various fish species contributing significantly to the region's ecological and economic dynamics (Todd et al., Reference Todd, Ong and Chou2010; Pomeroy et al., Reference Pomeroy, Garces, Pido, Parks and Silvestre2019). Tenualosa ilisha is a highly valued fish species in South Asia and some Middle Eastern countries (Hossain et al., Reference Hossain, Das, Genevier, Hazra, Rahman, Barange and Fernandes2019a; Hossain et al., Reference Hossain, Sharifuzzaman, Rouf, Pomeroy, Hossain, Chowdhury and AftabUddin2019b), where it has economic, cultural and ecological significance (Khan et al., Reference Khan, Wahab, Haque, Nahiduzzaman and Phillips2020; Bandara and Wijewardene, Reference Bandara and Wijewardene2023). They are anadromous fish and migrate from marine to freshwater environments for spawning (Bhaumik, Reference Bhaumik2015a; Hossain et al., Reference Hossain, Sharifuzzaman, Chowdhury and Sarker2016; Asaduzzaman et al., Reference Asaduzzaman, Wahab, Rahman, Nahiduzzzaman, Dickson, Igarashi, Asakawa and Wong2019b; Asaduzzaman et al., Reference Asaduzzaman, Wahab, Rahman, Nahiduzzaman, Rahman, Roy, Phillips and Wong2020). However, the distribution and population status of T. ilisha in different regions is poorly understood, especially in the Vietnamese water, where it was thought to be extinct due to overfishing, habitat degradation and climate change (Blaber et al., Reference Blaber, Milton, Brewer and Salini2023).

Previous studies on T. ilisha focused on its biology, ecology and fisheries management in the Bay of Bengal and the Persian Gulf (Bhaumik, Reference Bhaumik2017; Hossain et al., Reference Hossain, Das, Genevier, Hazra, Rahman, Barange and Fernandes2019a, Reference Hossain, Sharifuzzaman, Rouf, Pomeroy, Hossain, Chowdhury and AftabUddin2019b), where it is more abundant and accessible (Bhaumik, Reference Bhaumik2015a; Sarker et al., Reference Sarker, Sarker, Cahoon, Dipty, Bashar, Hasan, Mahmud and Sarker2023). However, consistent, reliable data on the occurrence, abundance and genetic diversity of T. ilisha in the South China Sea is lacking. Moreover, only one study documented the existence of T. ilisha in Vietnamese water but without support data (Nguyen and Nguyen, Reference Nguyen and Nguyen1994; Turan et al., Reference Turan, Ergüden, Gürlek and Turan2004). We aimed to survey T. ilisha in Vietnamese water and confirm the sampled species using both morphological and molecular data.

Materials and methods

We set up six trawling trips and surveyed from offshore to the estuary area of the Giang Thanh River, Kien Giang Province, Vietnam (Figure 1). Temperature and salinity were determined using a conventional CTD profiler (Compact-CTD Lite, JFE Advantech, accuracy ± 0.03) (Miyata et al., Reference Miyata, Mori, Kagehira, Miyazaki, Suzuki and Sato2016). Only one individual of Tenualosa species was captured on 16 October 2022 (Figure 2). Morphometric characters of the specimen were measured following a methodology outlined in a previous study (Arai and Amalina, Reference Arai and Amalina2014).

Figure 1. Collection sites of the Tenualosa specimen in the Kien Giang province of Vietnam. A black circle on the map indicates the sampling location.

Figure 2. Photograph showing the Tenualosa ilisha (418 mm in TL) collected in Vietnam.

Fin and tissue samples were preserved in 96% ethanol for subsequent analysis. DNA was extracted using an Ezup Column Animal Genomic DNA Purification Kit (Sangon, Shanghai, China). Cytochrome oxidase subunit I (COI) gene was amplified using standard COI gene primers designed for the Clupeiformes in our lab (COI-F GGAGCTACAATCCGCCGCCTA and COI-R GGTTCGATTCCTYCCTTTCTCGTT). Each PCR reaction contained 2.0 μl of DNA sample, 2.5 μl of each 10 μM of each primer, 50 μl of the QIAGEN Taq PCR Master Mix and 43 μl of distilled water. The PCR reaction condition was as follows: initial denaturation: 94°C for 5 min; 32 cycles of 94°C for 30 s, primer annealing at 62.9°C for 30 s and extension at 72°C for 1 min; with a final extension at 72°C for 7 min. Finally, the PCR products were analysed by using 1.5% agarose gel electrophoresis with Biotium – Gel Red. The sequences were determined through Sanger sequencing at Sangon Biotech. Chromatographs were used to check and edit sequences, which were assembled using Codon Code Aligner software (Centerville, MA, USA).

The COI gene sequence was lodged in NCBI as T. ilisha OR088067. The COI sequence was compared with the sequences of other Tenualosa for species identification using BLAST. The sequence obtained in this study also was aligned to other Tenualosa species (KX786670.1, KY751995.1, Nc 016682.1, NC 016719.1, MK572252.1) with Gudusia chapra (MK572252.1) as the outgroup using the MUSCLE algorithm. A neighbour-joining tree (NJ tree) was reconstructed under the Kimura 2-Parameter model selected by using MEGA XI (Mello, Reference Mello2018).

Results

The water parameters at the sampling location: temperature ranged from 28.4 to 31.7°C and salinity from 25.0 to 28.0 ppt. The specimen was 418 mm in length and 1428 g in weight, showing a size-weight correlation within its species (Nima et al., Reference Nima, Hossain, Rahman, Mawa, Hasan, Islam, Rahman, Tanjin, Sabbir, Bashar and Mahmud2020). It had a head length of 29.0% and pectoral fin length of 31.1% of its standard length, indicative of its unique body proportions (Salini et al., Reference Salini, Milton, Rahman and Hussain2004; Hossain et al., Reference Hossain, Rahman, Rahman, Islam, Rahman, Hasan, Mawa, Tanjin, Shakila, Sarmin and Chowdhury2022). Notably, the presence of 34 scutes aided in species identification (Tint et al., Reference Tint, Ko and Oo2019). The specimen showed a higher gill rakers count of 283, and a caudal fin length within the moderate range for Tenualosa species (Table 1), distinguishing it from T. macrura, T. toli and T. reevesii.

Table 1. Morphometric measure and meristic characters of the T. ilisha specimen

TL, total length; SL, standard length; g, grams.

The amplified COI gene of the specimen was 1532 bp in length and 98.76% match with T. ilisha sequences in GenBank (NC_016682.1). The reconstructed phylogenetic tree confirmed that the Giang Thanh River specimen is a T. ilisha (Figure 3). A close relationship between T. ilisha and T. toli was supported by a 100% bootstrap value.

Figure 3. Phylogenetic tree of four species of the Tenualosa genus based on cytochrome oxidase subunit I (COI) gene sequences and Gudusia chapra from the same family as the outgroup. The neighbour-joining (NJ) tree was reconstructed using K2P model with 10,000 replications for bootstrap analysis.

Discussion

Prior research suggested that the T. ilisha was extinct in the South China Sea (Arjunaidi et al., Reference Arjunaidi, Zakaria, Aziz, Shahreza, Jaafar, Seah and Asma2016; Blaber et al., Reference Blaber, Milton, Brewer and Salini2023). The discovery of them in Vietnamese Giang Thanh River suggests a broader migratory pattern or habitat adaptation within the Indo-Pacific region. The T. ilisha is an indigenous anadromous fish in the Indo-Pacific (Brierley and Kingsford, Reference Brierley and Kingsford2009; Hossain et al., Reference Hossain, Das, Genevier, Hazra, Rahman, Barange and Fernandes2019a), inhabiting the coasts, estuaries and rivers of southern Asia countries (Sahoo et al., Reference Sahoo, Wahab, Phillips, Rahman, Padiyar, Puvanendran, Bangera, Belton, De, Meena and Behera2018; Ghosh et al., Reference Ghosh, Rajawat, Nazir, Banerjee, Nath and Sakthivel2022). Its habitat preferences include extensive continental shelves (Hossain et al., Reference Hossain, Sharifuzzaman, Chowdhury and Sarker2016; Dwivedi, Reference Dwivedi2019), monsoonal influences, significant precipitation and runoff (Naskar et al., Reference Naskar, Chandra, Sahu and Raman2017; Leal Filho et al., Reference Leal Filho, Nagy, Martinho, Saroar, Erache, Primo, Pardal and Li2022), surface temperatures of 20–30°C (Kundu et al., Reference Kundu, Islam, Hasan, Saha, Mondal, Paul and Mustafa2020), seasonally shifting currents (Hossain et al., Reference Hossain, Sharifuzzaman, Rouf, Pomeroy, Hossain, Chowdhury and AftabUddin2019b), moderate organic productivity (Sarker et al., Reference Sarker, Rashid and Tanmay2016) and coastal waters with lower salinity (Mohindra et al., Reference Mohindra, Chowdhury, Chauhan, Paul, Singh, Kushwaha, Maurya, Lal and Jena2023). The water conditions at the sampling location are suitable for the T. ilisha's growth and survival (Fernandes et al., Reference Fernandes, Kay, Hossain, Ahmed, Cheung, Lazar and Barange2016; Das et al., Reference Das, Lauria, Kay, Cazcarro, Arto, Fernandes and Hazra2020; Dalpadado et al., Reference Dalpadado, Arrigo, van Dijken, Gunasekara, Ostrowski, Bianchi and Sperfeld2021). This finding is significant as it suggests that the Giang Thanh River could serve as a previously unrecognized habitat or migration pathway for this species. Nonetheless, further studies are essential to assess the population size, genetic variation and ecological impact of the T. ilisha in Vietnamese water.

The specimen has a shorter head and longer tail than T. toli and T. reevesii, similar head length and caudal fin length to T. macrura, but higher in the number of gill rakers than T. toli and T. macrura (Table 2). This variation possibly reflects its wide geographic range, ecological diversity, feeding habits and preferences (Borah et al., Reference Borah, Vaisakh, Jaiswar, Bhattacharjya, Deshmukhe, Sahoo, Gogoi, Meena, Mohanty and Das2022; Sarker et al., Reference Sarker, Sarker, Cahoon, Dipty, Bashar, Hasan, Mahmud and Sarker2023). These differences can distinguish T. ilisha from T. macrura, T. toli and T. reevesii, which often get confused due to their similar appearance and overlapping distribution (Bhaumik, Reference Bhaumik2015b). However, morphological identification alone may not be sufficient or accurate, and molecular genetic analysis is often needed to confirm the species identity and phylogenetic relationships of Tenualosa species.

Table 2. Distinctive biological characters and geographical distribution of five Tenualosa species found in Indo-Pacific region (Yakup et al., Reference Yakup, Taha, Metali, Ahmad and Arai2019)

CFL % of SL, ratio of caudal fin length for standard length.

Although T. ilisha is found in Bruneian and Malaysian waters (Azri et al., Reference Azri, Taha, Metali, Ahmad and Arai2020), only one record T. ilisha was found in Vietnam in 1994, with no supported data (Nguyen and Nguyen, Reference Nguyen and Nguyen1994). The complexity of visually identifying Tenualosa species needs molecular genetic analysis for validation. The confusion in morphological identification among these species can be attributed to their genetic similarities and differences (Rahman et al., Reference Rahman, Begum, Reza, Ahsan and Ahmed2018; Abdullah et al., Reference Abdullah, Al-Noor and Javadmanesh2021; Afrand et al., Reference Afrand, Sourinejad, Shahdadi and Vera2023). The BLAST analysis revealed that the T. ilisha sample from Kien Giang closely matched the Indian hilsa species, with a 2708 score reflecting a high gene sequence similarity. The 98.76% query cover confirms extensive sequence overlap, suggests a significant genetic link and a common evolutionary background between the two populations. The NJ tree (Figure 3) also suggested that the Kien Giang sample is T. ilisha.

The phylogenetic analysis indicated T. ilisha and T. toli are closely related (Figure 3), as evidenced by a 10,000 bootstrap value, suggesting a strong genetic link between the two species. This close relationship implies they share similar appearances and structures, which leads to confusion when naming them based solely on morphology. On the other hand, G. chapra, the outgroup species, appears to be distantly related to T. ilisha, and shows significant genetic divergence (Egana et al., Reference Egana, Bloomc, Kuoe, Hammerf, Tongnunuig, Iglésiash, Sheavesi, Grudpank and Simonsb2018; Milec et al., Reference Milec, Vanhove, Bukinga, De Keyzer, Kapepula, Masilya, Mulimbwa, Wagner and Raeymaekers2022). This genetic distance helps to clarify the evolutionary lineage of T. ilisha and its separation from the outgroup species (Sarker et al., Reference Sarker, Jiang, Naher, Huang, Sarker, Yin, Baki and Li2021; Sultana et al., Reference Sultana, Hasan, Hossain, Alim, Das, Moniruzzaman, Rahman, Salimullah and Alam2022).

The low genetic diversity and the presence of admixed individuals without precise grouping could further contribute to the morphological confusion (Jorde and Wooding, Reference Jorde and Wooding2004; Slovák et al., Reference Slovák, Kučera, Marhold and Zozomová-Lihová2012; Holm et al., Reference Holm, Elameen, Oliver, Brandsæter, Fløistad and Brurberg2018; Garmendia et al., Reference Garmendia, Merle, Sanía, López and Ferriol2022). Recent studies highlighted the low genetic variation within T. ilisha populations, suggesting a single panmictic population with admixture from other populations (Sarker et al., Reference Sarker, Jiang, Naher, Huang, Sarker, Yin, Baki and Li2021). Moreover, the genetic population structure of T. ilisha is influenced by its highly migratory nature (Mohindra et al., Reference Mohindra, Divya, Kumar, Singh, Dwivedi, Mandal, Masih, Lal and Jena2019; Habib et al., Reference Habib, Nam, Xiao, Sathi, Islam, Panhwar and Habib2022; Sultana et al., Reference Sultana, Hasan, Hossain, Alim, Das, Moniruzzaman, Rahman, Salimullah and Alam2022). The presence of distinct genetic barriers, limited gene flows and complex evolutionary processes has resulted in a significant population genetic and phylogeographic structure for T. ilisha (Asaduzzaman et al., Reference Asaduzzaman, Igarashi, Wahab, Nahiduzzaman, Rahman, Phillips, Huang, Asakawa, Rahman and Wong2019a; Habib et al., Reference Habib, Nam, Xiao, Sathi, Islam, Panhwar and Habib2022). The genetic relationships and evolutionary history of T. ilisha are complex and influenced by various factors, including migration patterns, genetic diversity and population structure (Asaduzzaman et al., Reference Asaduzzaman, Igarashi, Wahab, Nahiduzzaman, Rahman, Phillips, Huang, Asakawa, Rahman and Wong2019a, Reference Asaduzzaman, Wahab, Rahman, Nahiduzzaman, Rahman, Roy, Phillips and Wong2020). These factors play a crucial role in the morphological similarities and differences observed among Tenualosa species and have important implications for their identification and conservation.

Climate change significantly affects species distribution, as warmer temperatures and altered sea conditions disrupt marine ecosystems and migration (Harley et al., Reference Harley, Randall Hughes, Hultgren, Miner, Sorte, Thornber, Rodriguez, Tomanek and Williams2006; Brierley and Kingsford, Reference Brierley and Kingsford2009; Doney et al., Reference Doney, Ruckelshaus, Emmett Duffy, Barry, Chan, English, Galindo, Grebmeier, Hollowed and Knowlton2012). The presence of Tenualosa in Vietnam's Kien Giang Sea is influenced by climate change (Mitra and Mitra, Reference Mitra and Mitra2013), and ocean currents (Blaber, Reference Blaber2002; Habib et al., Reference Habib, Nam, Xiao, Sathi, Islam, Panhwar and Habib2022). The occurrence of T. ilisha in Malay and Brunei (Roberd et al., Reference Roberd, Taha, Metali, Ahmad and Arai2019; Yakup et al., Reference Yakup, Taha, Metali, Ahmad and Arai2019; Azri et al., Reference Azri, Taha, Metali, Ahmad and Arai2020) implies climate-driven range shifts explain its presence in the Kien Giang Sea. Genetic studies corroborate revealing the species' evolutionary links and possible migration routes (Asaduzzaman et al., Reference Asaduzzaman, Wahab, Rahman, Nahiduzzzaman, Dickson, Igarashi, Asakawa and Wong2019b, Reference Asaduzzaman, Wahab, Rahman, Nahiduzzaman, Rahman, Roy, Phillips and Wong2020). Closeness of India to the Kien Giang Sea suggests a dispersal path, aided by ocean currents serving as natural passageways. Comprehending these elements and their interactions is crucial for understanding the effects of climate change on marine life diversity and formulating effective preservation measures.

Conclusion

Our study confirmed the presence of T. ilisha in Vietnamese waters, a species once considered extinct locally. Utilizing the COI gene for molecular identification, we emphasize the necessity of refined molecular techniques testing uncertain morphological traits. The detection of T. ilisha indicates potential novel migratory routes, warranting further exploration of its movement and habitat choices, and reassessment of conservation tactics and the advocacy of sustainable fisheries to preserve its existence. Future research should target the ecological elements aiding endurance of T. ilisha in Vietnam and the development of collective management approaches with community, policy and research stakeholders.

Data availability

The data sets include morphological measurements and genetic sequences are available at NCBI: OR088067 of T. ilisha specimen collected from Vietnamese waters.

Acknowledgments

We acknowledge the following institutions for their contributions to this research: (1) Shanghai University Key Laboratory of Marine Animal Taxonomy and Evolution, Shanghai Ocean University, Shanghai 201306, China, for providing facilities, resources and expertise for morphological and genetic analyses; (2) Engineering Research Center of Environmental DNA and Ecological Water Health Assessment, Shanghai Ocean University, Shanghai 201306, China, for technical support and guidance in genetic analysis; (3) Institute of Aquaculture, Nha Trang University, Nha Trang, Vietnam, for collaboration and assistance in sample collection and field work. We thank our colleagues and students from these institutions for their contributions to various aspects of this study. This research was supported by grants from Science and Technology Commission of Shanghai Municipality (19410740500). We also thank the anonymous reviewers for their constructive comments and suggestions, which improved the quality of this manuscript.

Author contributions

Vanthu Giap conceived the study, designed and coordinated the research, performed molecular genetic studies and sequence alignment and drafted the manuscript. Md Rashedur Rahman conducted molecular genetic experiments. Chenhong Li provided resources, reviewed and edited the manuscript, supervised the project and provided funding. All authors read and approved the final manuscript.

Financial support

The project was funded by the ‘Science and Technology Commission of Shanghai Municipality (19410740500)’.

Competing interest

None.

Ethical standards

The Tenualosa ilisha specimen was collected and examined under the ethical standards and guidelines of the Institute of Aquaculture, Nha Trang University, Vietnam, and in compliance with local regulations and permissions granted by the appropriate Vietnamese authorities. The specimen's welfare and conservation were prioritized, and all ethical considerations, particularly regarding handling and identification, met international standards.

References

Abdullah, TA, Al-Noor, SS and Javadmanesh, A (2021) Genetic distance of anadromous Tenualosa ilisha (Hamilton, 1882) in Shatt al-Arab River based on partial sequencing of mitochondrial DNA. Agriculture and Natural Resources 55, 848–853.Google Scholar
Afrand, M, Sourinejad, I, Shahdadi, A and Vera, M (2023) DNA barcoding for identification and discovery of fish species in the protected mangroves of Hormozgan, Iran. Estuaries and Coasts 46, 1–15.Google Scholar
Arai, T and Amalina, R (2014) New record of a tropical shad Tenualosa ilisha (Teleostei: Clupeidae) in Malaysian waters. Marine Biodiversity Records 7, e66.CrossRefGoogle Scholar
Arjunaidi, NN, Zakaria, MF, Aziz, AHA, Shahreza, MS, Jaafar, TNAM, Seah, YG and Asma, AN (2016) Authentication of Tenualosa species in Perak River, Malaysia: Application of morphological measurement and molecular analysis of partial CO1 and 16S genes to resolve species ambiguity. Aquaculture, Aquarium, Conservation & Legislation 9(6), 1355–1363.Google Scholar
Asaduzzaman, M, Igarashi, Y, Wahab, MA, Nahiduzzaman, M, Rahman, MJ, Phillips, MJ, Huang, S, Asakawa, S, Rahman, MM and Wong, LL (2019a) Population genomics of an anadromous hilsa shad Tenualosa ilisha species across its diverse migratory habitats: discrimination by fine-scale local adaptation. Genes 11, 46.CrossRefGoogle ScholarPubMed
Asaduzzaman, M, Wahab, MA, Rahman, MJ, Nahiduzzzaman, M, Dickson, MW, Igarashi, Y, Asakawa, S and Wong, LL (2019b) Fine-scale population structure and ecotypes of anadromous hilsa shad (Tenualosa ilisha) across complex aquatic ecosystems revealed by NextRAD genotyping. Scientific Reports 9(1), 16050.CrossRefGoogle ScholarPubMed
Asaduzzaman, M, Wahab, MA, Rahman, MM, Nahiduzzaman, M, Rahman, MJ, Roy, BK, Phillips, MJ and Wong, LL (2020) Morpho-genetic divergence and adaptation of anadromous hilsa shad (Tenualosa ilisha) along their heterogenic migratory habitats. Frontiers in Marine Science, 7 Article 554.CrossRefGoogle Scholar
Azri, A, Taha, H, Metali, F, Ahmad, N and Arai, T (2020) Validation of occurrence and ecological implication of tropical shads Tenualosa ilisha and T. toli (Teleostei: Clupeidae) in Bruneian and Malaysian waters. Thalassas: An International Journal of Marine Sciences 36, 41–46.CrossRefGoogle Scholar
Bandara, T and Wijewardene, L (2023) Global research effort on hilsa shad (Tenualosa ilisha) – insights from scientometrics. Thalassas: An International Journal of Marine Sciences 39(2), 1–16.CrossRefGoogle Scholar
Bhaumik, U (2015a) Migration of hilsa shad in the Indo-Pacific region – a review. International Journal of Current Research and Academic Review 3, 139–155.Google Scholar
Bhaumik, U (2015b) Review of global studies on food, growth and maturity profile of Indian shad (Tenualosa ilisha). International Journal of Current Research and Academic Review 3, 127–139.Google Scholar
Bhaumik, U (2017) Fisheries of Indian shad (Tenualosa ilisha) in the Hooghly–Bhagirathi stretch of the Ganga River system. Aquatic Ecosystem Health & Management 20, 130–139.CrossRefGoogle Scholar
Blaber, S (2002) ‘Fish in hot water’: the challenges facing fish and fisheries research in tropical estuaries. Journal of Fish Biology 61, 1–20.Google Scholar
Blaber, SJ, Milton, DA, Brewer, DT and Salini, JP (2023) Biology, fisheries, and status of tropical shads Tenualosa spp. in south and southeast Asia. Proceedings of the American Fisheries Society Symposium, 2003. American Fisheries Society, pp. 49–58.Google Scholar
Borah, S, Vaisakh, G, Jaiswar, A, Bhattacharjya, B, Deshmukhe, G, Sahoo, A, Gogoi, P, Meena, D, Mohanty, D and Das, B (2022) Food spectrum dynamics of anadromous hilsa, Tenualosa ilisha (Hamilton, 1822) inhabiting River Brahmaputra, India curtailing apprehension of food selectivity: an insight into its domestication. Indian Journal of Geo-Marine Sciences (IJMS) 51, 67–77.Google Scholar
Brierley, AS and Kingsford, MJ (2009) Impacts of climate change on marine organisms and ecosystems. Current Biology 19, R602–R614.CrossRefGoogle ScholarPubMed
Dalpadado, P, Arrigo, KR, van Dijken, GL, Gunasekara, SS, Ostrowski, M, Bianchi, G and Sperfeld, E (2021) Warming of the Indian Ocean and its impact on temporal and spatial dynamics of primary production. Progress in Oceanography 198, 102688.CrossRefGoogle Scholar
Das, I, Lauria, V, Kay, S, Cazcarro, I, Arto, I, Fernandes, JA and Hazra, S (2020) Effects of climate change and management policies on marine fisheries productivity in the north-east coast of India. Science of the Total Environment 724, 138082.CrossRefGoogle ScholarPubMed
Doney, SC, Ruckelshaus, M, Emmett Duffy, J, Barry, JP, Chan, F, English, CA, Galindo, HM, Grebmeier, JM, Hollowed, AB and Knowlton, N (2012) Climate change impacts on marine ecosystems. Annual Review of Marine Science 4, 11–37.CrossRefGoogle ScholarPubMed
Dwivedi, A (2019) Morphometric variations between seasonal migrants of anadromous shad Tenualosa ilisha (Hamilton, 1822) from Hooghly Estuary, India. Marine and Freshwater Research 70, 1427–1435.CrossRefGoogle Scholar
Egana, JP, Bloomc, DD, Kuoe, C-H, Hammerf, MP, Tongnunuig, P, Iglésiash, SP, Sheavesi, M, Grudpank, C and Simonsb, AM (2018) Phylogenetic analysis of trophic niche evolution reveals a latitudinal herbivory gradient in Clupeoidei (herrings, anchovies, and allies). Molecular Phylogenetics and Evolution 124, 151–161.CrossRefGoogle Scholar
Fernandes, JA, Kay, S, Hossain, MA, Ahmed, M, Cheung, WW, Lazar, AN and Barange, M (2016) Projecting marine fish production and catch potential in Bangladesh in the 21st century under long-term environmental change and management scenarios. ICES Journal of Marine Science 73(5), 1357–1369.CrossRefGoogle Scholar
Garmendia, A, Merle, H, Sanía, M, López, C and Ferriol, M (2022) Morphologic, genetic, and biogeographic continua among subspecies hinder the conservation of threatened taxa: the case of Centaurea aspera ssp. scorpiurifolia (Asteraceae). Scientific Reports 12, 932.CrossRefGoogle ScholarPubMed
Ghosh, P, Rajawat, VS, Nazir, A, Banerjee, Y, Nath, AK and Sakthivel, T (2022) Stable isotope on hilsa shad (Tenualosa ilisha) otoliths revealed migratory behavior of a population found in Hooghly River, West Bengal, India. Environmental Biology of Fishes 105, 1909–1918.CrossRefGoogle Scholar
Habib, KA, Nam, K, Xiao, Y, Sathi, J, Islam, MN, Panhwar, SK and Habib, AS (2022) Population structure, phylogeography and demographic history of Tenualosa ilisha populations in the Indian Ocean region inferred from mitochondrial DNA sequence variation. Regional Studies in Marine Science 54, 102478.CrossRefGoogle Scholar
Harley, CD, Randall Hughes, A, Hultgren, KM, Miner, BG, Sorte, JC, Thornber, CS, Rodriguez, LF, Tomanek, L and Williams, SL (2006) The impacts of climate change in coastal marine systems. Ecology Letters 9(2), 228–241.CrossRefGoogle ScholarPubMed
Holm, AK, Elameen, A, Oliver, BW, Brandsæter, LO, Fløistad, IS and Brurberg, MB (2018) Low genetic variation of invasive Fallopia spp. in their northernmost European distribution range. Ecology and Evolution 8, 755–764.CrossRefGoogle ScholarPubMed
Hossain, M, Sharifuzzaman, S, Chowdhury, S and Sarker, S (2016) Habitats across the life cycle of hilsa shad (Tenualosa ilisha) in aquatic ecosystem of Bangladesh. Fisheries Management and Ecology 23, 450–462.CrossRefGoogle Scholar
Hossain, MA, Das, I, Genevier, L, Hazra, S, Rahman, M, Barange, M and Fernandes, JA (2019a) Biology and fisheries of hilsa shad in Bay of Bengal. Science of the Total Environment 651, 1720–1734.CrossRefGoogle ScholarPubMed
Hossain, MS, Sharifuzzaman, S, Rouf, MA, Pomeroy, RS, Hossain, MD, Chowdhury, SR and AftabUddin, S (2019b) Tropical hilsa shad (Tenualosa ilisha): biology, fishery and management. Fish and Fisheries 20(1), 44–65.CrossRefGoogle Scholar
Hossain, MY, Rahman, MA, Rahman, O, Islam, MA, Rahman, MA, Hasan, MR, Mawa, Z, Tanjin, S, Shakila, M, Sarmin, AN and Chowdhury, AA (2022) Morphological characteristics and length-weight relationships of hilsa shad Tenualosa ilisha (Hamilton, 1822) (Actinopterygii: Clupeidae) in the Ganges River, Bangladesh. Acta Zoologica Bulgarica 74, 75–83.Google Scholar
Hughes, AC (2017) Understanding the drivers of Southeast Asian biodiversity loss. Ecosphere 8, e01624.CrossRefGoogle Scholar
Jorde, LB and Wooding, SP (2004) Genetic variation, classification and ‘race’. Nature genetics 36, S28–S33.CrossRefGoogle ScholarPubMed
Khan, MA, Wahab, MA, Haque, AM, Nahiduzzaman, M and Phillips, MJ (2020) Value chain impact of the increased hilsa shad (Tenualosa ilisha) harvest in Bangladesh. International Food and Agribusiness Management Review 23, 355–368.CrossRefGoogle Scholar
Koh, LP and Sodhi, NS (2010) Conserving Southeast Asia's imperiled biodiversity: scientific, management, and policy challenges. Biodiversity and Conservation 19, 913–917.CrossRefGoogle Scholar
Kundu, GK, Islam, MM, Hasan, MF, Saha, S, Mondal, G, Paul, B and Mustafa, MG (2020) Patterns of fish community composition and biodiversity in riverine fish sanctuaries in Bangladesh: implications for hilsa shad conservation. Ecology of Freshwater Fish 29(2), 364–376.CrossRefGoogle Scholar
Leal Filho, W, Nagy, GJ, Martinho, F, Saroar, M, Erache, MG, Primo, AL, Pardal, MA and Li, C (2022) Influences of climate change and variability on estuarine ecosystems: an impact study in selected European, South American and Asian countries. International Journal of Environmental Research and Public Health 19, 585.CrossRefGoogle ScholarPubMed
Liu, J (2013) Status of marine biodiversity of the China Seas. PLoS ONE 8, e50719.CrossRefGoogle ScholarPubMed
Mello, B (2018) Estimating TimeTrees with MEGA and the TimeTree Resource. Molecular Biology and Evolution 35, 2334–2342.CrossRefGoogle ScholarPubMed
Milec, LJM, Vanhove, MPM, Bukinga, FM, De Keyzer, EL, Kapepula, VL, Masilya, PM, Mulimbwa, NS, Wagner, CE and Raeymaekers, JA (2022) Complete mitochondrial genomes and updated divergence time of the two freshwater clupeids endemic to Lake Tanganyika (Africa) suggest intralacustrine speciation. BMC Ecology and Evolution 22, 1–17.CrossRefGoogle ScholarPubMed
Mitra, A and Mitra, A (2013) Climate change and its impact on brackish water fish and fishery. Sensitivity of Mangrove Ecosystem to Changing Climate, pp 191–217.CrossRefGoogle Scholar
Miyata, N, Mori, T, Kagehira, M, Miyazaki, N, Suzuki, M and Sato, K (2016) Micro CTD data logger reveals short-term excursions of Japanese sea bass from seawater to freshwater. Aquatic Biology 25, 97–106.CrossRefGoogle Scholar
Mohindra, V, Divya, BK, Kumar, R, Singh, RK, Dwivedi, AK, Mandal, S, Masih, P, Lal, KK and Jena, JK (2019) Genetic population structure of a highly migratory hilsa shad, Tenualosa ilisha, in three river systems, inferred from four mitochondrial genes analysis. Environmental Biology of Fishes 102, 939–954.CrossRefGoogle Scholar
Mohindra, V, Chowdhury, LM, Chauhan, N, Paul, A, Singh, RK, Kushwaha, B, Maurya, RK, Lal, KK and Jena, JK (2023) Transcriptome analysis revealed osmoregulation related regulatory networks and hub genes in the gills of hilsa shad, Tenualosa ilisha, during the migratory osmotic stress. Marine Biotechnology 25, 161–173.CrossRefGoogle ScholarPubMed
Naskar, M, Chandra, G, Sahu, SK and Raman, RK (2017) A modeling framework to quantify the influence of hydrology on the abundance of a migratory Indian shad, the hilsa Tenualosa ilisha. North American Journal of Fisheries Management 37, 1208–1219.CrossRefGoogle Scholar
Nguyen, H and Nguyen, N (1994) Checklist of marine fishes in Vietnam. Vol. 2. Osteichthyes, from Elopiformes to Mugiliformes. Science and Technics Publishing House, Vietnam, 54–55.Google Scholar
Nima, A, Hossain, MY, Rahman, MA, Mawa, Z., Hasan, MR, Islam, MA, Rahman, MA, Tanjin, S, Sabbir, W, Bashar, MA and Mahmud, Y (2020) Temporal variations of length, weight, and condition of Hilsa shad, Tenualosa ilisha (Hamilton, 1822) in the Meghna River, Southeastern Bangladesh. Egyptian Journal of Aquatic Biology and Fisheries 24, 481–494.CrossRefGoogle Scholar
Pomeroy, RS, Garces, LR, Pido, MD, Parks, JE and Silvestre, G (2019) The role of scale within an ecosystem approach to fisheries management: policy and practice in Southeast Asian seas. Marine Policy 106, 103531.CrossRefGoogle Scholar
Rahman, A, Begum, M, Reza, H, Ahsan, M and Ahmed, M (2018) Molecular characterization of hilsa shads in Bangladesh using cytochrome C oxidase subunit 1 (CO1) gene. International Journal of Fauna and Biological Studies 5, 1–5.Google Scholar
Roberd, AA, Taha, H, Metali, F, Ahmad, N and Arai, T (2019) Validation of occurrence of tropical shads, Tenualosa ilisha (Hamilton, 1822) and T. toli (Valenciennes, 1847) (Teleostei, Clupeidae), in Malaysian waters. Check List 15, 65–69.CrossRefGoogle Scholar
Sahoo, AK, Wahab, MA, Phillips, M, Rahman, A, Padiyar, A, Puvanendran, V, Bangera, R, Belton, B, De, DK, Meena, DK and Behera, BK (2018) Breeding and culture status of hilsa (Tenualosa ilisha, Ham. 1822) in South Asia: a review. Reviews in Aquaculture 10, 96–110.CrossRefGoogle Scholar
Salini, J, Milton, D, Rahman, M and Hussain, M (2004) Allozyme and morphological variation throughout the geographic range of the tropical shad, hilsa Tenualosa ilisha. Fisheries Research 66, 53–69.CrossRefGoogle Scholar
Sarker, MJ, Rashid, F and Tanmay, M (2016) Assessment of coastal water habitat with reference to the variability of plankton during spawning season of Indian river shad in Greater Noakhali-Bangladesh. Journal of Ecosystem & Ecography 6, 197.CrossRefGoogle Scholar
Sarker, A, Jiang, J, Naher, H, Huang, J, Sarker, KK, Yin, G, Baki, MA and Li, C (2021) Cross-species gene enrichment revealed a single population of hilsa shad (Tenualosa ilisha) with low genetic variation in Bangladesh waters. Scientific Reports 11, 11560.CrossRefGoogle ScholarPubMed
Sarker, MJ, Sarker, PK, Cahoon, LB, Dipty, AK, Bashar, MA, Hasan, MM, Mahmud, Y and Sarker, MM (2023) Seasonal variation in the epibenthic feeding habits of hilsa shad (Tenualosa ilisha) in the Upper Meghna River Estuary, Bangladesh. Fishes 8, 335.CrossRefGoogle Scholar
Slovák, M, Kučera, J, Marhold, K and Zozomová-Lihová, J (2012) The morphological and genetic variation in the polymorphic species Picris hieracioides (Compositae, Lactuceae) in Europe strongly contrasts with traditional taxonomical concepts. Systematic Botany 37, 258–278.CrossRefGoogle Scholar
Sultana, S, Hasan, MM, Hossain, MS, Alim, MA, Das, KC, Moniruzzaman, M, Rahman, MH, Salimullah, M and Alam, J (2022) Assessment of genetic diversity and population structure of Tenualosa ilisha in Bangladesh based on partial sequence of mitochondrial DNA cytochrome b gene. Ecological Genetics and Genomics 25, 100139.CrossRefGoogle Scholar
Tint, K, Ko, Z and Oo, N (2019) Morphological identifications and morphometric measurements of genus Tenualosa spp. fowler, 1934 (Family Clupeidae) in Mon coastal areas, Myanmar. Journal of Aquaculture & Marine Biology 8, 17–22.CrossRefGoogle Scholar
Todd, PA, Ong, X and Chou, LM (2010) Impacts of pollution on marine life in Southeast Asia. Biodiversity and Conservation 19, 1063–1082.CrossRefGoogle Scholar
Turan, C, Ergüden, D, Gürlek, M and Turan, F (2004) Genetic and morphologic structure of Liza abu (Heckel, 1843) populations from the rivers Orontes, Euphrates and Tigris. Turkish Journal of Veterinary & Animal Sciences 28, 729–734.Google Scholar
Yakup, NF, Taha, H, Metali, F, Ahmad, N and Arai, T (2019) Validation of occurrence of a tropical shad Tenualosa toli (Teleostei: Clupeidae) in Brunei Darussalam. Tropical Ecology 60, 299–302.CrossRefGoogle Scholar
Figure 0

Figure 1. Collection sites of the Tenualosa specimen in the Kien Giang province of Vietnam. A black circle on the map indicates the sampling location.

Figure 1

Figure 2. Photograph showing the Tenualosa ilisha (418 mm in TL) collected in Vietnam.

Figure 2

Table 1. Morphometric measure and meristic characters of the T. ilisha specimen

Figure 3

Figure 3. Phylogenetic tree of four species of the Tenualosa genus based on cytochrome oxidase subunit I (COI) gene sequences and Gudusia chapra from the same family as the outgroup. The neighbour-joining (NJ) tree was reconstructed using K2P model with 10,000 replications for bootstrap analysis.

Figure 4

Table 2. Distinctive biological characters and geographical distribution of five Tenualosa species found in Indo-Pacific region (Yakup et al., 2019)