Introduction
Ferris and Ferris (Reference Ferris and Ferris1973) proposed the new genus Lindseyus, with L. costatus as its type and only species, collected from freshwater habitats in Indiana, USA. It was characterized by, among other traits, having a long and slender body, faint basket-like cheilostom, very small odontostyle, belondirid pharyngeal expansion, and sexual dimorphism in tail shape, being regarded as a member of Roqueidae Thorne, Reference Thorne1964 and compared with Roqueus Thorne, Reference Thorne1964. Later, three other species were added to the catalogue of the genus. Dhanachand and Jairajpuri (Reference Dhanachand and Jairajpuri1980) described L. indicus from India. Coomans and Kheiri 1986 transferred Dorylaimellus heterurus Schuurmans-Stekhoven & Teunissen, Reference Schuurmans-Stekhoven and Teunissen1938 (= Roqueus africanus Andrássy, 1970) to Lindseyus. And Choi and Khan (Reference Choi and Khan1999) described the fourth species, L. juwangens, from Korea.
Coomans and Kehiri (Reference Coomans and Kheiri1986) provided an excellent morphological study of L. costatus and revised the taxonomy of both Roqueus and Lindseyus, which were classified in the tribe Roqueini Thorne, Reference Thorne1964, subfamily Swangeriinae Jairajpuri, Reference Jairajpuri1964, family Belondiridae Thorne, Reference Thorne1939. Subsequent contributions raised some controversy about the position of Lindseyus in the Dorylaimida system. Thus, Jairajpuri and Ahmad (Reference Jairajpuri and Ahmad1992) included it in Swangeriinae, but did not recognize the tribe Roqueini; meanwhile, Andrássy (Reference Andrássy2009) classified it in Swangeriidae Jairajpuri, Reference Jairajpuri1964, Roqueinae Thorne, Reference Thorne1964. Unfortunately, no molecular study of a Lindseyus representative has so far been accomplished.
The presence of L. costatus in Iran was previously reported by Coomans and Kheiri (Reference Coomans and Kheiri1986) and Shahabi et al. (Reference Shahabi, Kheiri, Rakhshandehroo and Jamali2016). A nematological survey recently conducted to explore the nematode diversity of this country resulted in the finding of a small population of the species, making possible the obtaining of fresh specimens for their molecular study aimed at providing new evidence to elucidate the evolutionary relationships of the genus. The results are presented in the following.
Material and Methods
Sampling, nematodes extraction, mounting, and microscopic studies
Several soil samples were collected near Gazeh village, Sepiddasht rural district, Khorramabad county, Lorestan province, western Iran in spring 2023 (2023-6-6). Nematodes were directly extracted from soil using a series of 20, 60, and 270 mesh sieves (USA standard mesh numbers) having 850-, 250-, and 53-μm openings size, respectively. A few specimens of interest were handpicked under a Nikon SMZ1000 stereomicroscope, heat-killed by adding boiling 4% formalin solution, transferred to anhydrous glycerin according to De Grisse (Reference De Grisse1969), mounted on permanent slides, and examined using a Nikon Eclipse E600 light microscope. Photographs were taken using a Nikon Eclipse 80i light microscope provided with DIC (differential interference contrast) optics and a Nikon Digital Sight DS-U1 camera.
DNA extraction, polymerase chain reaction, sequencing, and phylogenetic analyses
DNA was separately extracted from two specimens by their squashing on a clean slide using a cover slip and TE buffer (10 mM Tris-Cl, 0.5 mMEDTA; pH 9.0). DNA samples were stored at −20 °C until being used as polymerase chain reaction templates. The 18S rDNA was amplified using the combination of the following primers: forward 988F (5´-CTCAAAGATTAAGCCATGC- 3´) and reverse 1912R (5´-TTTACGGTCAGAACTAGGG- 3´) (Holterman et al. Reference Holterman, van derWurff, van den Elsen, van Megen, Bongers, Holovachov, Bakker and Helder2006), forward primer SSU22F (5´-TCCAAGGAAGGCAGCAGGC- 3´), and reverse primer SSU13R (5´-GGGCATCACAGACCTGTTA- 3´) (Dorris et al. Reference Dorris, Viney and Blaxter2002), forward primer 965F (5´-GGCGATCAGATACCGCCCTAGTT- 3´) (Mullin et al. Reference Mullin, Harris and Powers2005), and reverse primer 2646R (5´-GCTACCTTGTTACGACTTTT- 3´) (Holterman et al. Reference Holterman, van derWurff, van den Elsen, van Megen, Bongers, Holovachov, Bakker and Helder2006). The D2–D3 expansion segments of 28S rDNA were amplified using the primer pairs: forward D2A (5´‐ACAAGTACCGTGAGGGAAAGT‐3´) and reverse D3B (5´-TGCGAAGGAACCAGCTACTA‐3´) (Nunn, Reference Nunn1992). The thermal cycling program for amplification of all aforementioned genomic fragments was as follows: denaturation at 95 °C for 4 min, followed by 32 cycles of denaturation at 94 °C for 30 s, annealing at 50–52 °C for 30–60 s, and extension at 72 °C for 1 min. A final extension was performed at 72 °C for 10 min. DNA sequencings were performed using the same primers used in polymerase chain reaction.
For phylogenetic analyses, newly generated 18S and 28S sequences were compared with those other nematode species available in GenBank using the BLAST homology search program (https://www.ncbi.nlm.nih.gov/). The selected 18S sequences including the new sequence were aligned using the Q-INS-i algorithm of the online version of MAFFT v.7 (https://mafft.cbrc.jp/alignment/server/index.html) (Katoh & Standley Reference Katoh and Standley2013) and post-edited manually. The selected 28S sequences including the newly generated sequence were aligned similar to SSU dataset, and the alignment was post-edited with Gblocks program (version 0.91b), with all three less stringent parameters (http://phylogeny.lirmm.fr/phylo_cgi/one_task.cgi?task_type=gblocks). The model of base substitution for each dataset was selected using MrModeltest 2 (Nylander Reference Nylander2004). The Akaike supported model, a general time reversible model, including among-site rate heterogeneity and estimates of invariant sites (GTR + G + I) was used in both 18S and 28S analyses. Bayesian analysis was performed using MrBayes v3.1.2 (Ronquist and Huelsenbeck Reference Ronquist and Huelsenbeck2003) running the chains for 10×106 generations. After discarding burn-in samples, the remaining samples were retained for further analyses. The Markov chain Monte Carlo method within a Bayesian framework was used to estimate the posterior probabilities of the phylogenetic trees (Larget & Simon Reference Larget and Simon1999) using the 50% majority rule. Convergence of model parameters and topology were assessed based on average standard deviation of split frequencies and potential scale reduction factor values. Adequacy of the posterior sample size was evaluated using autocorrelation statistics as implemented in Tracer v.1.6 (Rambaut & Drummond Reference Rambaut and Drummond2009). Sequences of Clavicaudoides clavicaudatus (Altherr, Reference Altherr1953) Heyns, Reference Heyns1968 and Aquatides aquaticus (Thorne, Reference Thorne1930) Heyns, Reference Heyns1968 species were used as outgroups for the 18S tree (species and accession numbers in the tree) and sequences of Mononchus truncatus Bastian, Reference Bastian1865 and Prionchulus punctatus Cobb, Reference Cobb1917 were used as outgroups for the 28S tree (species and accession numbers in the tree). The output files of the trees were visualized using Dendroscope V.3.2.8 (Huson & Scornavacca Reference Huson and Scornavacca2012) and digitally drawn in CorelDRAW software version 17. The Bayesian posterior probability values exceeding 0.50%, are given on appropriate clades.
Results
Identification of the material examined and comparison with previously reported populations
Lindseyus costatus was very well characterized by Coomans and Kehiri (1986), who provided precise details of its morphology, a comprehensive table of measurements and ratios, and myriad excellent line illustrations, giving nice information for comparative purposes. The general morphology (Figs 1 & 2) of the Iranian specimens examined here perfectly fit those provided by these authors. Regarding their morphometrics (Table 1), they are in general concordance with those previously known, especially with those of another Iranian population studied by Coomans and Kheiri (op. cit.). Nevertheless, some differences in some measurements and ratios are noted too. First, the general size of the specimens here studied is larger, particularly appreciable in female body length (5.87-6.90 vs 4.30-5.67 mm in a total of 20 specimens of three different populations) and less so in the case of males (4.58-5.96 vs 4.10-4.81 mm in a total of seven specimens). Second, and more interestingly, two male secondary sexual traits apparently differ in a significant way as the nematodes here studied bear longer spicules (66-73 vs 44-61 μm long) and higher number of ventromedian supplements (10-13 vs 5-8). These differences are provisionally regarded as intraspecific variability of the species, and a possible consequence of the low number of specimens studied so far, especially in the case of males.
Figure 1. Light microphotographs of Lindseyus costatus Ferris & Ferris, Reference Ferris and Ferris1973 from Lorestan province, Iran (female). A: Anterior body region, latero-median view. B: Pharyngo-intestinal junction. C: Oviduct-uterus junction. D: Vagina. E: Neck region. F: Anterior genital branch. G: Prerectum. H: Caudal region. Scale bars: A = 5 μm; B = 20 μm; C, D = 10 μm; E, G, H = 50 μm; F = 100 μm.
Table 1. Morphometrics of a new Iranian population of Lindseyus costatus Ferris & Ferris, Reference Ferris and Ferris1973 (measurements in μm, except L in mm, and in the form average ± standard deviation [range])
References: 1 – Ferris & Ferris (Reference Ferris and Ferris1973); 2 – Coomans & Kehiri (Reference Coomans and Kheiri1986); 3 – Ebsary (Reference Ebsary1984).
Figure 2. Light microphotographs of Lindseyus costatus Ferris & Ferris, Reference Ferris and Ferris1973 from Lorestan province, Iran (male). A: Anterior body region, latero-median view. B: Pharyngeal expansion. C: Pharyngo-intestinal junction. D: Ventromedian supplements. E: Anterior region, lateral surface view, showing amphid aperture. F: Posterior body region. G: Caudal region and spicule. H: Spicule. I: Sperm cells. J: DN with two nucleoli. Scale bars: A, E, J = 5 μm; B-D, G = 20 μm; F = 50 μm; H, I = 10 μm.
Molecular characterization of the material examined
After sequencing and editing, two sequences were obtained for phylogenetic analyses. One 18S rDNA sequence 1481-bp long (acc. PP868171) showed 99.12% identity to a SSU sequence (KM092519) assigned to Amblydorylaimus isokaryon (Loof, Reference Loof1975) Andrássy, Reference Andrássy1998, 99.12% to a sequence (DQ141212) assigned to Aporcelaimellus obtusicaudatus (Bastian, 1965) Altherr, Reference Altherr1968, and 99.05% to another A. obtusicaudatus sequence (AY284811). Surprisingly, it was only 98.24% identical to a sequence (AY284824) assigned to Oxydirus oxycephalus (de Man, 1885) Thorne, Reference Thorne1939 and 97.97% to a sequence (AY284823) assigned to O. oxycephaloides (de Man, Reference de Man1921) Thorne, Reference Thorne1939, these corresponding to two members of the family Belondiridae and the subfamily Swangeriinae.
One 28S rDNA sequence 604-bp long (acc. PP868173) was 86.74% identical to a sequence (MK920111) assigned to Makatinus aquaticus Jiménez-Guirado, Reference Jiménez-Guirado1994, and less than 86% to several sequences of the genus Aporcelaimellus Heyns, Reference Heyns1965.
Evolutionary relationships of the genus Lindseyus
Morphologically, Lindseyus displays a peculiar combination of key traits: very short odontostyle for large to very large nematodes, extremely short neck (b > 10), pharyngeal expansion enveloped by a strong sinistral spiral muscular sheath, cardia embraced by intestine only at its posterior part, and tail with sexual dimorphism. These features should be regarded at least as relevant synapomorphies of the genus, which conform a very recognizable pattern and support the monophyly of the taxon. Lindseyus is very close to Roqueus, both mainly differing in the nature of the spiral sheath surrounding their pharyngeal expansion: with strongly sinistral vs almost straight muscular bands, respectively. Coomans and Kheiri (Reference Coomans and Kheiri1986) emphasized the importance of this difference, regarded the sinistral sheath observed in Lindseyus, a very unusual trait in Belondiridae, as an apomorphic condition, and proposed the tribe Roqueini to accommodate both genera.
Present molecular analysis is the first one provided for a Lindseyus representative and its results are presented in the corresponding trees of Fig. 3 (18S rDNA) and Fig. 4 (28S rDNA). In both cases, the evolutionary relationships of L. costatus are difficult to elucidate for several reasons. First, branching of the trees is poorly resolved. Second, L. costatus sequences form part of weakly supported (87% and 58%, respectively) clades. Third, there is not a close relationship of these sequences with other belondirid ones, even appearing separated from Oxydirus sequences, tentatively their closest taxon. Fourth, 18S tree shows L. costatus sequence forming part of a maximally supported clade together with a sequence identified as cf. Oxydirus sp, from Costa Rica, which probably belongs to a Lindseyus population.
Present results provide additional data about the identity of L. costatus, but add more doubts than certainties about the evolutionary relationships of belondirid taxa. Thus, the polyphyly of Belondiridae is once more reasserted, with Oxydirus sequences situated far from other representatives of the family, but now the monophyly of Swangeriinae is also questioned as Lindseyus and Oxydirus sequences neither appear close in the molecular trees, an issue that should be cleared up in the future with further studies.
Figure 3. Bayesian 50% majority rule consensus tree inferred using 18S rDNA sequences of Lindseyus costatus Ferris & Ferris, Reference Ferris and Ferris1973 from Lorestan province, Iran, under GTR+I+G model. Bayesian posterior probabilities values exceeding 0.50 are given for appropriate clades. Newly obtained sequence is in bold font. Scale bar = expected changes per site.
Figure 4. Bayesian 50% majority rule consensus tree inferred using 28S rDNA D2-D3 sequences of Lindseyus costatus Ferris & Ferris, Reference Ferris and Ferris1973 from Lorestan province, Iran, under GTR+I+G model. Bayesian posterior probabilities values exceeding 0.50 are given for appropriate clades. Newly obtained sequence is in bold font. Scale bar = expected changes per site.
Taxonomy of the genus Lindseyus
Diagnosis
Belondiridae, Swangeriinae, Roqueini. Large- to very large-sized nematodes, 3.46-7.25-mm long, with very slender body. Cuticle dorylaimid. Lip region rounded, continuous with the adjoining body, with amalgamated lips. Amphid fovea goblet-like, with aperture occupying ca two-thirds of the lip region diameter. Cephalic framework, if present, is weakly sclerotized. Cheilostom is a truncate cone with thin walls. Odontostyle short and attenuate but showing visible lumen and aperture. Guiding ring simple. Odontophore rod-like, lacking any differentiation. Pharynx extremely short (b-ratio 12-28), entirely muscular, abruptly enlarging into the basal expansion that occupies less than one-half of the total neck length and is surrounded by a conspicuous sinistrally spiral sheath of musculature. Cardia tongue-like, only partially enveloped by intestinal tissue. Female genital system diovarian, with very well-developed pars refringens vaginae and transverse vulva. Tail dissimilar in sexes, long and filiform in females, short and rounded conoid in male. Spicules dorylaimid. Ventromedian supplements 5-14 in number, shortly spaced in general, with large hiatus.
Etymology
Originally named after Prof. A.A. Lindsey, ecologist at Purdue University, Indiana, USA.
Type species:
L. costatus Ferris & Ferris, Reference Ferris and Ferris1973
Other species:
L. heterurus (Schuurmans-Stekhoven & Teunissen Reference Schuurmans-Stekhoven and Teunissen1938) Coomans & Kheiri, Reference Coomans and Kheiri1986
= Dorylaimellus heterurus Schuurmans-Stekhoven & Teunissen, Reference Schuurmans-Stekhoven and Teunissen1938
= Dorylaimus heterurus (Schuurmans-Stekhoven & Teunissen Reference Schuurmans-Stekhoven and Teunissen1938) Heyns, Reference Heyns1963
= Paradorylaimus heterurus (Schuurmans-Stekhoven & Teunissen Reference Schuurmans-Stekhoven and Teunissen1938) Andrássy, Reference Andrássy1969
= Roqueus heterurus (Schuurmans-Stekhoven & Teunissen Reference Schuurmans-Stekhoven and Teunissen1938) Mulk, Coomans & Baqri, 1978
= Roqueus africanus Andrássy, 1970
= Lindseyus africanus (Andrássy, 1970) Coomans & Kheiri, Reference Coomans and Kheiri1986
L. indicus Dhanachand & Jairajpuri, Reference Dhanachand and Jairajpuri1980
L. juwangens Choi & Khan, Reference Choi and Khan1999
Key to species identification
Table 2 provides a compendium of main morphometrics of species.
Table 2. Compendium of morphometrics of species belonging to the genus Lindseyus Ferris & Ferris, Reference Ferris and Ferris1973 (measurements in μm except L in mm)
1 Abbreviations: Lrd: Lip region diameter. Odont.: Odontostyle length. Ph. exp.: Pharyngeal expansion length. Prerect.: Prerectum length. Spicul.: Spicule length. Ve. sup.: Number of ventromedian supplements.
2 References. 1 – Ferris and Ferris (Reference Ferris and Ferris1973). 2 – Coomans and Kheiri (Reference Coomans and Kheiri1986). 3 – Ebsary (Reference Ebsary1984). 4 – Present paper. 5 – Schuurmans-Stekhoven and Teunissen (Reference Schuurmans-Stekhoven and Teunissen1938). 6 – Mulk et al. (Reference Mulk, Coomans and Baqri1978). 7 – Jiménez-Guirado (Reference Jiménez-Guirado1989). 8 – Jiménez-Guirado and Murillo-Navarro (Reference Jiménez-Guirado and Murillo-Navarro2004). 9 – Jiménez-Guirado et al. (Reference Jiménez-Guirado, Peralta, Peña-Santiago and Ramos2007). 10 – Andrássy (Reference Andrássy1970a). 11 – Andrássy (Reference Andrássy1970b). 12 – Dhanachand & Jairajpuri (Reference Dhanachand and Jairajpuri1980). 13 – Choi & Khan (Reference Choi and Khan1999).
3 Specimens from two or more locations.
4 Calculated from illustrations and/or other morphometrics.
Remarks
Lindseyus is a well-characterized, homogeneous genus. Morphologically, it displays a very recognizable pattern, with only minor interspecific differences. Morphometrically, however, it shows wide variations in the main measurements and ratios, at least in its oldest species, namely L. costatus and L. heterurus. These two species, which were described in great details by Coomans and Kehiri (Reference Coomans and Kheiri1986) and Mulk et al. (Reference Mulk, Coomans and Baqri1978; see also Jiménez-Guirado and Murillo-Navarro Reference Jiménez-Guirado and Murillo-Navarro2004), respectively, significantly differ in the absence/presence of strong cuticular differentiations at both sides of the vulva, a remarkable trait that was observed in the three contributions (Andrássy, Reference Andrássy1970a; Mulk et al. Reference Mulk, Coomans and Baqri1978; Jiménez-Guirado & Murillo-Navarro Reference Jiménez-Guirado and Murillo-Navarro2004) in which L. heterurus populations were studied. Besides, L. costatus bears somewhat smaller odontostyle than L. heterurus (4-5 vs 5-7 μm, respectively). It would be interesting to confirm such differences by means of molecular analyses. Another different question is the identity of the two youngest species, namely L. indicus and L. juwangens, whose original (and only available) descriptions are not so well-detailed.
Dhanachand and Jairajpuri (Reference Dhanachand and Jairajpuri1980) distinguished L. indicus from type population of L. costatus in (p. 163) “the shape of lip region, in having a longer odontostyle but smaller odontophore and cardia, in the shape and size of spicules and lateral guiding pieces and in the number of ventromedian supplements (odontostyle = 5-6 μm, odontophore 22 μm, lateral guiding pieces tapered and ventromedian supplements 7 in L. costatus”. Nevertheless, these differences are fewer when L. indicus is compared with other L. costatus populations later recorded (for instance, see data provided in Table 2), being reduced to slightly smaller males (3.46-3.83, n = 6 vs 4.10-6.26 mm, n = 12, respectively) and, most importantly, significantly longer odontostyle (8-11 vs 4-5 μm). Nevertheless, Dhanachand and Jairajpuri’s original illustrations 4B, C suggest that odontostyle might be shorter than indicated by the authors, perhaps comparable to that of L. costatus. (See also Coomans and Kheiri’s (Reference Coomans and Kheiri1986) discussion about the difficulties to measure the odontostyle in Lindseyus populations.)
Choi and Khan (Reference Choi and Khan1999) described L. juwangens on the basis of only two females and one male and distinguished it from type population of L. costatus in having (p. 33) “shorter body length (3.4-4.0 mm vs 4.3-5.6 mm); more slender body (a = 83.6-94.4 vs a=67.2-86.3); shorter tail length (0.29-0.34 mm vs 0.35-0.57 mm) and in the number of ventromedian supplements 7 in L. costatus”. Notwithstanding, these morphometrical differences are minimum when all the available information about L. costatus is taken into account (see Table 2).
Acknowledgements
The kind assistance of the late father of the first author during our samplings is appreciated. This research was financially supported by Tarbiat Modares University. The Spanish author (R.P.S.) is thankful for the financial support of the University of Jaén, Spain, through the research program ‘PAIUJA 2023/2024: EI_RNM2_2023’.
