Hostname: page-component-cd9895bd7-gbm5v Total loading time: 0 Render date: 2024-12-22T18:08:43.112Z Has data issue: false hasContentIssue false
  • English
  • Français

The small heat shock protein Hsp20.8 imparts tolerance to high temperatures in the leafminer fly, Liriomyza trifolii (Diptera: Agtomyzidae)

Published online by Cambridge University Press:  13 March 2024

Yue Zhang ,
Ya-Wen Chang Open the ORCID record for Ya-Wen Chang [Opens in a new window] ,
Yu-Cheng Wang ,
Yu-Qing Yan  and
Yu-Zhou Du Open the ORCID record for Yu-Zhou Du [Opens in a new window]
Yue Zhang
Affiliation:
College of Plant Protection, Yangzhou University, Yangzhou, China
Ya-Wen Chang*
Affiliation:
College of Plant Protection, Yangzhou University, Yangzhou, China
Yu-Cheng Wang
Affiliation:
College of Plant Protection, Yangzhou University, Yangzhou, China
Yu-Qing Yan
Affiliation:
College of Plant Protection, Yangzhou University, Yangzhou, China
Yu-Zhou Du*
Affiliation:
College of Plant Protection, Yangzhou University, Yangzhou, China Joint International Research Laboratory of Agriculture and Agri-Product Safety, The Ministry of Education, Yangzhou University, Yangzhou, China
*
Corresponding author: Ya-Wen Chang; Email: [email protected]
Corresponding author: Ya-Wen Chang; Email: [email protected]
Rights & Permissions [Opens in a new window]

Abstract

As an environmental factor, temperature impacts the distribution of species and influences interspecific competition. The molecular chaperones encoded by small heat shock proteins (sHsps) are essential for rapid, appropriate responses to environmental stress. This study focuses on Hsp20.8, which encodes a temperature-responsive sHsp in Liriomyza trifolii, an insect pest that infests both agricultural and ornamental crops. Hsp20.8 expression was highest at 39℃ in L. trifolii pupae and adults, and expression levels were greater in pupae than in adults. Recombinant Hsp20.8 was expressed in Escherichia coli and conferred a higher survival rate than the empty vector to bacterial cells exposed to heat stress. RNA interference experiments were conducted using L. trifolii adults and prepupae and the knockdown of Hsp20.8 expression increased mortality in L. trifolii during heat stress. The results expand our understanding of sHsp function in Liriomyza spp. and the ongoing adaptation of this pest to climate change. In addition, this study is also important for predicting the distribution of invasive species and proposing new prevention and control strategies based on temperature adaptation.

Keywords

high-temperature treatmentHsp20.8Liriomyza trifoliiRNA interferencestress response
Type
Research Paper
Information
Bulletin of Entomological Research , Volume 114 , Issue 2 , April 2024 , pp. 230 - 236
Copyright
Copyright © The Author(s), 2024. Published by Cambridge University Press

Introduction

In insects, heat shock proteins (HSPs) are important contributors to temperature stress tolerance and also operate as molecular chaperones (Gehring and Wehner, Reference Gehring and Wehner1995; Johnston et al., Reference Johnston, Ward and Kopito1998; Feder and Hofmann, Reference Feder and Hofmann1999; Hu et al., Reference Hu, Chen and Li2014). Small heat shock proteins (sHSPs) provide a level of thermoprotection and have diverse functions and structures (Gehring and Wehner, Reference Gehring and Wehner1995; Franck et al., Reference Franck, Madsen, van Rheede, Ricard, Huynen and de Jong2004). Specifically, sHSPs are known for their chaperone activity and conserved α-crystallin domains (Basha et al., Reference Basha, O'Neill and Vierling2012; Haslbeck and Vierling, Reference Haslbeck and Vierling2015). They function to promote the correct folding of proteins that accumulate due to different stressors and also inhibit aggregation of proteins (Basha et al., Reference Basha, O'Neill and Vierling2012; King and MacRae, Reference King and MacRae2015). sHsps have been associated with multiple physiological responses, including tolerance to thermal stress (Tsvetkova et al., Reference Tsvetkova, Horváth, Török, Wolkers, Balogi, Shigapova, Crowe, Tablin, Vierling, Crowe and Vigh2002; Sun and MacRae, Reference Sun and MacRae2005; Zhao and Jones, Reference Zhao and Jones2012).

sHSPs in insects have gained significant attention over the past few decades because of their involvement in stress tolerance, which fosters adaptation to difficult environmental conditions. The function of sHSPs differs both between and within insect during different developmental stages, physiological states and environmental conditions (Haslbeck and Vierling, Reference Haslbeck and Vierling2015; King and MacRae, Reference King and MacRae2015; Jagla et al., Reference Jagla, Dubińska-Magiera, Poovathumkadavil, Daczewska and Jagla2018). For example, sHsp expression profiles in Frankliniella occidentalis varied among different developmental stages and environmental conditions (Yuan et al., Reference Yuan, Song, Chang, Yang, Xie, Gong and Du2022). sHsps have been studied in fruit flies (Morrow et al., Reference Morrow, Heikkila and Tanguay2006), rice stem borers (Lu et al., Reference Lu, Hua, Cui and Du2014; Pan et al., Reference Pan, Lu, Li and Du2018; Dong et al., Reference Dong, Zhu, Lu and Du2021) and honeybees (Liu et al., Reference Liu, Xi, Kang, Guo and Xu2012; Zhang et al., Reference Zhang, Liu, Guo, Li, Gao, Guo and Xu2014); unfortunately, their mode of action and function remain unclear. It is essential to study individual sHSPs in insects to better understand their functional diversity and their role in helping pests adapt to climate change.

The leafminer Liriomyza trifolii (Diptera: Agtomyzidae) is an insidious pest that causes damage to various crops on a global scale (Spencer, Reference Spencer and Göttingen1973). The larvae of L. trifolii produce tunnels in plant foliage, and the adult stage punctures leaves for both feeding and oviposition (Johnson et al., Reference Johnson, Welter, Toscano, Ting and Trumble1983; Parrella et al., Reference Parrella, Jones, Youngman and Lebeck1985; Reitz et al., Reference Reitz, Kund, Carson, Phillips and Trumble1999). The initial report of L. trifolii in mainland China occurred after an earlier invasion by other Liriomyza spp. (Wen et al., Reference Wen, Wang and Lei1996, Reference Wen, Lei and Wang1998; Wang et al., Reference Wang, Guan and Chen2007). Temperature has a critical role in the Liriomyza development and distribution, and minor variations in thermotolerance can disrupt the competitive balance between related species (Kang et al., Reference Kang, Chen, Wei and Liu2009; Wang et al., Reference Wang, Reitz, Xiang, Smagghe and Lei2014a, Reference Wang, Rreitz, Wang, Wang, Xue and Lei2014b). Numerous studies have been conducted to investigate the effects of temperature and thermally regulated interspecific competition on Liriomyza spp. (Reitz and Trumble, Reference Reitz and Trumble2002; Abe and Tokumaru, Reference Abe and Tokumaru2008; Wang et al., Reference Wang, Reitz, Xiang, Smagghe and Lei2014a, Reference Wang, Rreitz, Wang, Wang, Xue and Lei2014b). Additionally, high- and low-temperature stress were shown to induce Hsp and sHsp expression in three closely related Liriomyza species, suggesting their role in heat stress (Huang and Kang, Reference Huang and Kang2007; Chang et al., Reference Chang, Zhang, Lu, Du and Zhu-Salzman2019, Reference Chang, Wang, Zhang, Iqbal, Lu and Du2021b).

We previously reported the occurrence of five sHsps in L. trifolii and showed that Hsp20.8 is expressed at significantly higher levels than other sHsps in adults and pupae (Chang et al., Reference Chang, Zhang, Lu, Du and Zhu-Salzman2019, Reference Chang, Wang, Zhang, Iqbal, Lu and Du2021b). Furthermore, RNA interference (RNAi) experiments with heat shock transcription factor 1 (Hsf1) resulted in decreased expression of Hsp20.8 and increased mortality under high temperatures, which suggests a role in adaptation to adverse temperatures (Chang et al., Reference Chang, Wang, Zhang, Iqbal, Lu and Du2021b). However, our understanding of sHsps in L. trifolii remains incomplete, and there is a lack of research on their function. This study focuses on the function of Hsp20.8 in L. trifolii during high-temperature stress to better understand how Liriomyza spp. adapt to thermal stress during climate change.

Materials and methods

Insects

In the laboratory, L. trifolii populations were maintained at 25 ± 1°C with a photoperiod of 16:8 h (L:D) as described previously (Chen and Kang, Reference Chen and Kang2002). Bean (Phaseolus vulgaris) was used to rear L. trifolii, and leaves exhibiting tunnels were gathered for pupation. Pupae were transferred to test tubes until emergence. Both larvae and adults were reared on beans for mating and oviposition.

Heat stress and expression of Hsp20.8

Two-day-old pupae and newly emerged adults were treated with temperatures ranging from 35 to 43°C for 2 h, frozen in liquid nitrogen and stored at −80°C. Controls were incubated at 25°C. The experiment was repeated three times.

The RNA-easy Isolation Reagent (Vazyme, China, #R701) was utilised to isolate RNA from L. trifolii, and RNA quality was measured as described (Chang et al., Reference Chang, Zhang, Lu, Du and Zhu-Salzman2019). Total RNA (0.5 μg) was used for reverse transcription in 20 μl volumes as described (Chang et al., Reference Chang, Zhang, Lu, Du and Zhu-Salzman2019). The experiment was performed with triplicate samples, and primers are listed in table 1.

Table 1. Primers used in recombinant protein amplification, dsRNA synthesis, and real-time quantitative PCR

EcoRI and Xhol restriction enzyme sites are underlined; the T7 promoter sequences are in bold.

Heterologous expression and validation of recombinant Hsp20.8

The Hsp20.8 ORF in L. trifolii was amplified using primers that incorporated EcoRI and Xhol sites (table 1). After PCR and EcoRI/Xhol digestion, the amplification product was ligated into pET-28a (Novagen, Beijing, China) and transformed into Escherichia coli BL21(DE3) competent cells. Transformants were cultured in Luria–Bertani (LB) broth with 50 mg l−1 kanamycin and incubated at 37°C with agitation at 200 rpm. When the cultures reached an absorbance of 0.5–0.8 at 600 nm, isopropyl β-D-1-thiogalactopyranoside (IPTG) was added at a final concentration of 0.5 mM. Cultures were then incubated an additional 24 h at 16°C with agitation at 200 rpm. Bacteria cells were pelleted by centrifugation at 6000 × g for 10 min at 4°C, suspended in lysis buffer (10 mM imidazole, NaCl, NaH2PO4.2H2O, pH 7.9–8.1), and sonicated (Sonics, CT, USA). Lysates were centrifuged at 18,000 × g for 15 min at 4°C, and the collected supernatants were then applied to Ni-NTA SefinoseTM resin as recommended by the manufacturer (Sangon Biotech, Shanghai, China). Proteins were separated by electrophoresis in 12% (v/v) SDS-polyacrylamide gels.

For western blots, proteins were transferred to polyvinylidene difluoride membranes and incubated with anti-His⋅tag rabbit antiserum horseradish peroxidase-conjugated goat anti-rabbit IgG (1:4000; Sangon Biotech) as described (Dong et al., Reference Dong, Liu, Li, Li, Li and Liu2022). Chemiluminescence signals were detected with the ECL western blot kit (Bio-Rad, CA, USA).

Bacterial survival assays

Ten millilitres of E. coli BL21 cells harbouring pET28a-LtHsp20.8 or the empty vector pET28a were cultured at 200 rpm in LB medium at 37°C. When the cells reached OD600 = 0.3, 0.5 mM IPTG was added and bacteria cultivated at 45°C for 6 h; the OD600 was measured hourly. Cells were then diluted 2000-fold in fresh LB, and 200 μl aliquots were distributed to LB agar containing 50 mg l−1 kanamycin. Bacteria were incubated at 37°C overnight and colony-forming units (CFUs) were recorded. The experiments were repeated three times.

dsRNA synthesis and RNAi

Small interfering RNA sequences were identified in the LtHsp20.8 sequence with siDirect v. 2.0 (http://sidirect2.rnai.jp/) and used for designing dsRNA primers. A T7 promoter sequence (TAATACGACTCACTATAGGG) was integrated into to the 5′ ends of primers to facilitate transcription from sense and antisense cDNA strands. A dsRNA specific for green fluorescence protein (GFP) was included as a control (table 1). Synthesis of dsRNA was accomplished using purified DNA template (1.5 μg), and the products were purified using the Transcript Aid T7 High Yield Transcription Kit (Thermo, USA, #K0441). Gel electrophoresis and spectrophotometry were used to evaluate the quality and quantity of dsRNA.

To prepare insects for microinjection, adults were anaesthetised with CO2 and a Nanoliter Injector (WPI, FL, USA) was used to deliver a 5 nl aliquot (50 ng) of dsHsp20.8 into L. trifolii. The insects were supplied with a honey/water solution and dead insects were removed as needed (Chang et al., Reference Chang, Wang, Zhang, Iqbal and Du2021a).

Newly emerged prepupae collected from leaf tissue were also used in RNAi experiments. Prepupae were immersed for 30 s in a solution containing 1% RNATransMate (Sangon Biotech) and 500 ng μl−1 dsHsp20.8 or dsGFP (control). Excess solution containing dsRNA was removed using a soft brush to prevent blockage of stomata and potential interference with pupation (Chang et al., Reference Chang, Wang, Yan, Xie, Yuan and Du2022). Leaf samples were collected, RNA was extracted and the efficiency of silencing was analysed by qPCR.

To measure silencing efficiency, adults and pupae were exposed to 39°C for 2 h. The efficiency of dsRNA silencing was then measured at 24 h post-injection (adults) and 48 h post-immersion (pupae) by qRT-PCR; primers are shown in table 1. Additionally, survival rates were determined for treatments containing ten injected adults and ten immersed pupae. The numbers of viable adults and eclosed pupae were tallied after exposure to 39°C for 2 h. Treatments were repeated four times.

Statistical analyses

Hsp20.8 expression was determined at different temperatures using the 2−ΔΔCt method (Livak and Schmittgen, Reference Livak and Schmittgen2001), and Actin was used as a reference gene (Chang et al., Reference Chang, Chen, Lu, Gao, Tian, Gong, Zhu and Du2017b). One-way ANOVA (Tukey's multiple comparison) was used to identify significant differences among temperature treatments. The Student's t test was utilised to identify differences in OD600 values and CFUs in Hsp20.8 and the control, and the relative abundance of survival rates and target genes and were compared to the dsGFP control. SPSS v. 16.0 (SPSS, Chicago, IL, USA) was used to transform data for homogeneity of variances. Differences were considered statistically significant at P < 0.05.

Results

Hsp20.8 expression during heat stress

Expression of Hsp20.8 was evaluated in L. trifolii pupae and adults during heat stress. Results showed that Hsp20.8 expression was significantly higher in temperatures ranging from 35 to 43°C in both development stages as compared to the control at 25°C (pupae: F 5,12 = 163.706, P < 0.05; adults: F 5,12 = 64.948, P < 0.05). Expression of Hsp20.8 was highest at 39℃; at this time point, transcript levels were 38.72- and 14.35-fold greater than the control in pupae and adults, respectively (fig. 1). In general, Hsp20.8 expression was significantly higher in pupae as compared to adults.

Figure 1. Relative expression levels of LtHsp20.8 under high-temperature treatments. The relative level of Hsp expression represented the fold increase as compared with the expression in controls. (a) Relative expression levels for pupae; (b) relative expression levels for adults. The data were denoted as mean ± SE. One-way analysis of variance (ANOVA) was used to analyse the relative expression levels of Hsp20.8 under high-temperature treatments. For the ANOVA, data were tested for homogeneity of variances and normality. Different lowercase letters indicate significant differences among different temperature treatments. Tukey's multiple range test was used for pairwise comparison for mean separation (P < 0.05).

Protective effects of LtHSP20.8 against heat stress

The function of LtHSP20.8 was investigated in E. coli by generating a recombinant protein fused with a 6 × His⋅tag (fig. 2a). Western blot analysis revealed the presence of LtHSP20.8 at approximately 20–25 kDa (fig. 2b). Survival assays after exposure to 45℃ were conducted with E. coli cells containing LtHsp20.8 and the empty vector. Cells that were overproducing LtHspP20.8 exhibited significantly higher tolerance to elevated temperatures as compared to the control cells. The OD600 values of E. coli containing LtHsp20.8 began to increase significantly after 4 h of heat shock as compared to control cells (t 4h = −3.283, P < 0.05; t 5h = −3.916, P < 0.05; t 6h = −4.984, P < 0.05), whereas the OD600 values of the control group remained unchanged (fig. 3a). The viability of E. coli cells subjected to high-temperature stress was determined by counting CFUs after exposure to thermal stress. Survival rates of the E. coli control decreased significantly after heat stress, whereas cells that overexpressed LtHsp20.8 exhibited higher survival rates (t = −6.625, P < 0.05) (fig. 3c).

Figure 2. Recombinant LtHSP20.8 protein was (a) heterologously expressed in Escherichia coli and (b) verified by Western blotting. ‘pET-28a’ represents the empty vector. The arrowheads indicate the position of LtHSP20.8.

Figure 3. LtHSP20.8 displays protective effect against heat stress. Escherichia coli cells containing pET-28a-LtHSP20.8 plasmid and pET-28a empty vector were grown in medium under heat stress (45°C). (a) The growth curve of the bacteria was recorded every hour. (b) After a 6 h culture under heat stress, E. coli cells with or without overexpressing LtHSP20.8 were spread on LB agar plates, and grown at 37°C overnight. (c) The number of bacteria colony-forming units (CFUs) on the LB agar plates were counted. Data are means ± SE. ‘*’ denotes a significant difference between two groups (Student's t test, P < 0.05).

Silencing Hsp20.8 decreases heat tolerance in L. trifolii

When newly emerged adults were injected with dsHsp20.8, expression of LtHsp20.8 showed a significant decrease (55.13%) as compared to that with dsGFP under 39℃ for 2 h treatment (t = 2.909, P < 0.05). After exposure to 39°C for 2 h, mortality significantly increased in L. trifolii injected with dsHsp20.8 (66.67%) as compared to dsGFP (50.00%) (t = −2.673, P < 0.05) (fig. 4).

Figure 4. Knockdown of LtHsp20.8 by RNA interference and its effect on heat tolerance in adult stage. (a) Injection of dsRNA of LtHsp20.8 significantly reduced the expression level of LtHsp20.8 compared to the flies injected with dsRNA of green fluorescent protein (dsGFP) under heat stress. (b) Mortality of dsLtHsp20.8-injected and dsGFP-injected flies exposed to heat stress. Data are presented as means ± SE. ‘*’ indicate a significant difference between two groups (Student's t test, P < 0.05).

RNAi was also performed by immersing L. trifolii prepupae in dsHsp20.8 and dsGFP. The expression Hsp20.8 in L. trifolii decreased significantly when exposed to 500 ng μl−1 of dsHsp20.8, and expression levels were 66.87% of the dsGFP control (t = 3.799, P < 0.05). Furthermore, the mortality rate of L. trifolii pupae (69.38%) was significantly higher when immersed in dsHsp20.8 and exposed to 39°C for 2 h as compared to the dsGFP control (43.33%) (t = −3.398, P < 0.05) (fig. 5).

Figure 5. Knockdown of LtHsp20.8 by RNA interference and its effect on heat tolerance in pupae stage. (a) Immersion of dsRNA of LtHsp20.8 significantly reduced the expression level of LtHsp20.8 compared to the flies immersed with dsRNA of green fluorescent protein (dsGFP) under heat stress. (b) Mortality of ds LtHsp20.8-immersed and dsGFP-immersed flies exposed to heat stress. Data are presented as means ± SE. ‘*’ indicate a significant difference between two groups (Student's t test, P < 0.05).

Discussion

This study shows that LtHsp20.8 was significantly upregulated during high-temperature stress in L. trifolii adults and pupae, and the expression patterns were consistent with other L. trifolii Hsps (Chang et al., Reference Chang, Chen, Lu, Gao, Tian, Gong, Dong and Du2017a, Reference Chang, Chen, Lu, Gao, Tian, Gong, Zhu and Du2017b, Reference Chang, Zhang, Lu, Du and Zhu-Salzman2019, Reference Chang, Wang, Zhang, Iqbal, Lu and Du2021b). Hsp20.8 is more highly expressed than other sHsps of L. trifolii in both pupal and adult stages (Chang et al., Reference Chang, Zhang, Lu, Du and Zhu-Salzman2019, Reference Chang, Wang, Zhang, Iqbal, Lu and Du2021b). Previous studies have shown that a 2 h exposure results in maximal expression of Hsps in L. trifolii (Chang et al., Reference Chang, Wang, Zhang, Iqbal, Lu and Du2021b); however, research is lacking on the effects of a 2 h exposure to different temperatures. In this study, we show that Hsp20.8 expression was highest at 39℃, and this temperature was used for functional verification. Expression of Hsp20.8 was higher in pupae than adults, which is consistent with our research and that of the highest expression level during the pupal stage under 1 h treatment is about five times that of the adult stage (Chang et al., Reference Chang, Zhang, Lu, Du and Zhu-Salzman2019, Reference Chang, Wang, Zhang, Iqbal, Lu and Du2021b). In nature, L. trifolii pupae must resist environmental stress, and it has been reported that L. trifolii overwinters in the pupal form (Kang et al., Reference Kang, Chen, Wei and Liu2009).

The production and assay of recombinant proteins is commonly used to verify protein function in vitro (Baneyx, Reference Baneyx1999). For example, the role of Hsps in peach aphids exposed to reactive oxygen species (ROS) was investigated by overproducing recombinant Hsps in E. coli and exposing bacterial cells to ROS generators (Dong et al., Reference Dong, Liu, Li, Li, Li and Liu2022). To study the role of AccsHsp22.6 in Apis cerana cerana, the protein was overproduced in E. coli and disc diffusion assays were used to evaluate the protective activity of the protein during oxidative stress (Zhang et al., Reference Zhang, Liu, Guo, Li, Gao, Guo and Xu2014).

Several reports have documented the accumulation of sHSPs in cells, and these were shown to protect cytoplasmic proteins from damage due to thermal stress (Derocher et al., Reference Derocher, Helm, Lauzon and Vierling1991; Pacheco et al., Reference Pacheco, Pereira, Almeida and Sousa2009). Furthermore, in vitro studies have demonstrated that several sHSPs possess the ability to prevent thermal aggregation under various conditions (Pérez-Morales et al., Reference Pérez-Morales, Ostoa-Saloma and Espinoza2009; Li et al., Reference Li, Yang, Lu, Chen and Yang2012; Liu et al., Reference Liu, Xi, Kang, Guo and Xu2012). In this study, the induction of LtHsp20.8 led to a higher survival rate in E. coli during heat stress, which is similar to results with other sHSPs. We recognise that in vitro results need to be combined with in vivo functions to verify protein function in the cell.

Using established methods for delivering dsRNA (microinjection and immersion), we obtained similar levels of interference for Hsp20.8 during high-temperature stress. In the model species, Caenorhabditis elegans, soaking in a dsRNA solution was similar to results obtained with amending the diet with dsRNA; however, in both cases RNAi was less potent than delivery by microinjection (Tabara et al., Reference Tabara, Grishok and Mello1998). Although microinjection is technically more difficult and results high in mortality, the adult stage of pests is easy to collect (Chang et al., Reference Chang, Wang, Zhang, Iqbal and Du2021a). Microinjection has been widely used to evaluate gene functions in the corn planthopper, Western flower thrips and other species (Yao et al., Reference Yao, Rotenberg, Afsharifar, Barandoc-Alviar and Whitfield2013; Badillo-Vargas et al., Reference Badillo-Vargas, Rotenberg, Schneweis and Whitfield2015; Joga et al., Reference Joga, Zotti, Smagghe and Christiaens2016). Although the soaking method is simple and has been utilised in some species as an dsRNA delivery method, it has primarily been used with larvae (Tabara et al., Reference Tabara, Grishok and Mello1998; Zhang et al., Reference Zhang, Li, Guan and Miao2015). The delivery of dsRNA by immersion is more effective for insect cells than intact insect bodies, and this is possibly due to physical barriers in adults such as the cuticle. In this study, we soaked prepupae of L. trifolii in dsRNAs. The pre-pupation period for dipteran insects is short, which makes them difficult to collect (Spencer, Reference Spencer and Göttingen1973). Even with the extra barriers present in insect bodies, the uptake of dsRNA is possible (Yu et al., Reference Yu, Christiaens, Liu, Niu, Cappelle, Caccia, Huvenne and Smagghe2013). For example, Ostrinia furnalalis larvae were sprayed with a dsRNA solution, which resulted in substantial mortality (Wang et al., Reference Wang, Zhang, Li and Miao2011). This application method suggests that dsRNAs can penetrate the integument and elicit RNAi, which suggests that RNAi-based pest management is a possible.

In this study, Hsp20.8 was induced in both pupae and adults during thermal stress. The role of Hsp20.8 in the heat stress response was verified in vitro by expressing recombinant Hsp20.8 in E. coli and exposing cells to heat shock. Furthermore, the exposure of L. trifolii adults and prepupae to dsHsp20.8 increased mortality during heat stress. With respect to climate change, the adaptation of insects to thermal stress presents obstacles to preventing their dissemination. It is critical to study the adaptation pests to environmental changes, and this is particularly important for L. trifolii, which is adaptable to various temperatures and is highly invasive. This study expands our knowledge of sHsp function in Liriomyza spp. and provides theoretical guidance on the ongoing adaptation of invasive pests to global climate change.

Data availability statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.

Acknowledgements

This research was funded by the National Natural Science Foundation of China (32202275), the National Key Research and Development Program of China (2022YFC2601100), the start-up project of high-level talent of Yangzhou University (137012465) and science and innovation fund project of Yangzhou University (X20220618).

Competing interests

None.

References

Abe, Y and Tokumaru, S (2008) Displacement in two invasive species of leafminer fly in different localities. Biological Invasions 10, 951–953.10.1007/s10530-007-9173-2CrossRefGoogle Scholar
Badillo-Vargas, IE, Rotenberg, D, Schneweis, BA and Whitfield, AE (2015) RNA interference tools for the western flower thrips, Frankliniella occidentalis. Journal of Insect Physiology 76, 36–46.10.1016/j.jinsphys.2015.03.009CrossRefGoogle ScholarPubMed
Baneyx, F (1999) Recombinant protein expression in Escherichia coli. Current Opinion in Biotechnology 10, 411–421.10.1016/S0958-1669(99)00003-8CrossRefGoogle ScholarPubMed
Basha, E, O'Neill, H and Vierling, E (2012) Small heat shock proteins and α-crystallins: dynamic proteins with flexible functions. Trends in Biochemical Sciences 37, 106–117.10.1016/j.tibs.2011.11.005CrossRefGoogle ScholarPubMed
Chang, YW, Chen, JY, Lu, MX, Gao, Y, Tian, ZH, Gong, WR, Dong, CS and Du, YZ (2017a) Cloning and expression of genes encoding heat shock proteins in Liriomyza trifolii and comparison with two congener leafminer species. PLoS ONE 12, e0181355.10.1371/journal.pone.0181355CrossRefGoogle ScholarPubMed
Chang, YW, Chen, JY, Lu, MX, Gao, Y, Tian, ZH, Gong, WR, Zhu, W and Du, YZ (2017b) Selection and validation of reference genes for quantitative real-time PCR analysis under different experimental conditions in the leafminer Liriomyza trifolii (Diptera: Agromyzidae). PLoS ONE 12, e0181862.10.1371/journal.pone.0181862CrossRefGoogle ScholarPubMed
Chang, YW, Zhang, XX, Lu, MX, Du, YZ and Zhu-Salzman, K (2019) Molecular cloning and characterization of small heat shock protein genes in the invasive leaf miner fly, Liriomyza trifolii. Genes 10, 775.10.3390/genes10100775CrossRefGoogle ScholarPubMed
Chang, YW, Wang, YC, Zhang, XX, Iqbal, J and Du, YZ (2021a) RNA interference of genes encoding the vacuolar-ATPase in Liriomyza trifolii. Insects 12, 41.10.3390/insects12010041CrossRefGoogle ScholarPubMed
Chang, YW, Wang, YC, Zhang, XX, Iqbal, J, Lu, MX and Du, YZ (2021b) Transcriptional regulation of small heat shock protein genes by heat shock factor 1 (HSF1) in Liriomyza trifolii under heat stress. Cell Stress and Chaperones 26, 835–843.10.1007/s12192-021-01224-2CrossRefGoogle ScholarPubMed
Chang, YW, Wang, YC, Yan, YQ, Xie, HF, Yuan, DR and Du, YZ (2022) RNA interference of chitin synthase 2 gene in Liriomyza trifolii through immersion in double-stranded RNA. Insects 13, 832.10.3390/insects13090832CrossRefGoogle ScholarPubMed
Chen, B and Kang, L (2002) Cold hardiness and supercooling capacity in the pea leafminer Liriomyza huidobrensis. Cryo Letters 23, 173–182.Google ScholarPubMed
Derocher, AE, Helm, KW, Lauzon, LM and Vierling, E (1991) Expression of a conserved family of cytoplasmic low molecular weight heat shock proteins during heat stress and recovery. Plant Physiology 96, 1038–1047.10.1104/pp.96.4.1038CrossRefGoogle ScholarPubMed
Dong, CL, Zhu, F, Lu, MX and Du, YZ (2021) Characterization and functional analysis of Cshsp19.0 encoding a small heat shock protein in Chilo suppressalis (Walker). International journal of Biological Macromolecules 188, 924–931.CrossRefGoogle ScholarPubMed
Dong, B, Liu, XY, Li, B, Li, MY, Li, SG and Liu, S (2022) A heat shock protein protects against oxidative stress induced by lambda-cyhalothrin in the green peach aphid Myzus persicae. Pesticide Biochemistry and Physiology 181, 104995.CrossRefGoogle ScholarPubMed
Feder, ME and Hofmann, GE (1999) Heat-shock proteins, molecular chaperones, and the stress response: evolutionary and ecological physiology. Annual Review of Physiology 61, 243–282.10.1146/annurev.physiol.61.1.243CrossRefGoogle ScholarPubMed
Franck, E, Madsen, O, van Rheede, T, Ricard, G, Huynen, MA and de Jong, WW (2004) Evolutionary diversity of vertebrate small heat shock proteins. Journal of Molecular Evolution 59, 792–805.10.1007/s00239-004-0013-zCrossRefGoogle ScholarPubMed
Gehring, WJ and Wehner, R (1995) Heat shock protein synthesis and thermotolerance in Cataglyphis, an ant from the Sahara desert. Proceedings of the National Academy of Sciences of the USA 92, 2994–2998.10.1073/pnas.92.7.2994CrossRefGoogle ScholarPubMed
Haslbeck, M and Vierling, E (2015) A first line of stress defense: small heat shock proteins and their function in protein homeostasis. Journal of Molecular Biology 427, 1537–1548.10.1016/j.jmb.2015.02.002CrossRefGoogle ScholarPubMed
Hu, JT, Chen, B and Li, ZH (2014) Thermal plasticity is related to the hardening response of heat shock protein expression in two Bactrocera fruit flies. Journal of Insect Physiology 67, 105–113.10.1016/j.jinsphys.2014.06.009CrossRefGoogle Scholar
Huang, LH and Kang, L (2007) Cloning and interspecific altered expression of heat shock protein genes in two leafminer species in response to thermal stress. Insect Molecular Biology 16, 491–500.CrossRefGoogle ScholarPubMed
Jagla, T, Dubińska-Magiera, M, Poovathumkadavil, P, Daczewska, M and Jagla, K (2018) Developmental expression and functions of the small heat shock proteins in Drosophila. International Journal of Molecular Sciences 19, 3441.CrossRefGoogle ScholarPubMed
Joga, MR, Zotti, MJ, Smagghe, G and Christiaens, O (2016) RNAi efficiency, systemic properties, and novel delivery methods for pest insect control: what we know so far. Frontiers in Physiology 7, 553.10.3389/fphys.2016.00553CrossRefGoogle ScholarPubMed
Johnson, MW, Welter, SC, Toscano, NC, Ting, P and Trumble, JT (1983) Reduction of tomato leaflet photosynthesis rates by mining activity of Liriomyza sativae (Diptera: Agromyzidae). Journal of Economic Entomology 76, 1061–1063.10.1093/jee/76.5.1061CrossRefGoogle Scholar
Johnston, JA, Ward, CL and Kopito, RR (1998) Aggresomes: a cellular response to misfolded proteins. The Journal of Cell Biology 143, 1883–1898.10.1083/jcb.143.7.1883CrossRefGoogle ScholarPubMed
Kang, L, Chen, B, Wei, JN and Liu, TX (2009) Roles of thermal adaptation and chemical ecology in Liriomyza distribution and control. Annual Review of Entomology 54, 127–145.10.1146/annurev.ento.54.110807.090507CrossRefGoogle Scholar
King, AM and MacRae, TH (2015) Insect heat shock proteins during stress and diapause. Annual Review of Entomology 60, 59–75.CrossRefGoogle ScholarPubMed
Li, DC, Yang, F, Lu, B, Chen, DF and Yang, WJ (2012) Thermotolerance and molecular chaperone function of the small heat shock protein HSP20 from hyperthermophilic archaeon, Sulfolobus solfataricus P2. Cell Stress and Chaperones 17, 103–108.10.1007/s12192-011-0289-zCrossRefGoogle ScholarPubMed
Liu, Z, Xi, D, Kang, M, Guo, X and Xu, B (2012) Molecular cloning and characterization of Hsp27.6: the first reported small heat shock protein from Apis cerana cerana. Cell Stress and Chaperones 17, 539–551.10.1007/s12192-012-0330-xCrossRefGoogle ScholarPubMed
Livak, KJ and Schmittgen, TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25, 402–408.CrossRefGoogle ScholarPubMed
Lu, MX, Hua, J, Cui, YD and Du, YZ (2014) Five small heat shock protein genes from Chilo suppressalis: characteristics of gene, genomic organization, structural analysis, and transcription profiles. Cell Stress and Chaperones 19, 91–104.CrossRefGoogle ScholarPubMed
Morrow, G, Heikkila, JJ and Tanguay, RM (2006) Differences in the chaperone-like activities of the four main small heat shock proteins of Drosophila melanogaster. Cell Stress and Chaperones 11, 51–60.10.1379/CSC-166.1CrossRefGoogle ScholarPubMed
Pacheco, A, Pereira, C, Almeida, MJ and Sousa, MJ (2009) Small heat-shock protein Hsp12 contributes to yeast tolerance to freezing stress. Microbiology 155, 2021–2028.10.1099/mic.0.025981-0CrossRefGoogle ScholarPubMed
Pan, DD, Lu, MX, Li, QY and Du, YZ (2018) Characteristics and expression of genes encoding two small heat shock protein genes lacking introns from Chilo suppressalis. Cell Stress and Chaperones 23, 55–64.10.1007/s12192-017-0823-8CrossRefGoogle ScholarPubMed
Parrella, MP, Jones, VP, Youngman, RR and Lebeck, LM (1985) Effect of leaf mining and leaf stippling of Liriomyza spp. on photosynthetic rates of chrysanthemum. Annals of the Entomological Society of America 78, 90–93.10.1093/aesa/78.1.90CrossRefGoogle Scholar
Pérez-Morales, D, Ostoa-Saloma, P and Espinoza, B (2009) Trypanosoma cruzi SHSP16: characterization of an alpha-crystallin small heat shock protein. Experimental Parasitology 123, 182–189.10.1016/j.exppara.2009.06.019CrossRefGoogle ScholarPubMed
Reitz, SR and Trumble, JT (2002) Interspecific and intraspecific differences in two Liriomyza leafminer species in California. Entomologia Experimentalis et Applicata 102, 101–113.CrossRefGoogle Scholar
Reitz, SR, Kund, GS, Carson, WG, Phillips, PA and Trumble, JT (1999) Economics of reducing insecticide use on celery through low-input pest management strategies. Agriculture Ecosystems and Environment 73, 185–197.10.1016/S0167-8809(99)00016-XCrossRefGoogle Scholar
Spencer, KA (1973) Series Entomologica. In Göttingen, ES (ed.), Agromyzidae (Diptera) of Economic Importance, 1st Edn. Vol. 9. Bath: The Hague Publishers, pp. 19–28.10.1007/978-94-017-0683-4CrossRefGoogle Scholar
Sun, Y and MacRae, TH (2005) Small heat shock proteins: molecular structure and chaperone function. Cellular and Molecular Life Sciences: CMLS 62, 2460–2476.10.1007/s00018-005-5190-4CrossRefGoogle ScholarPubMed
Tabara, H, Grishok, A and Mello, CC (1998) RNAi in C. elegans: soaking in the genome sequence. Science 282, 430–431.10.1126/science.282.5388.430CrossRefGoogle Scholar
Tsvetkova, NM, Horváth, I, Török, Z, Wolkers, WF, Balogi, Z, Shigapova, N, Crowe, LM, Tablin, F, Vierling, E, Crowe, JH and Vigh, L (2002) Small heat-shock proteins regulate membrane lipid polymorphism. Proceedings of the National Academy of Sciences of the USA 99, 13504–13509.10.1073/pnas.192468399CrossRefGoogle ScholarPubMed
Wang, ZG, Guan, W and Chen, DH (2007) Preliminary report of the Liriomyza trifolii in Zhongshan area. Plant Quarantine 21, 19–20.Google Scholar
Wang, Y, Zhang, H, Li, H and Miao, X (2011) Second-generation sequencing supply an effective way to screen RNAi targets in large scale for potential application in pest insect control. PLoS ONE 6, e18644.10.1371/journal.pone.0018644CrossRefGoogle ScholarPubMed
Wang, H, Reitz, SR, Xiang, J, Smagghe, G and Lei, Z (2014a) Does temperature-mediated reproductive success drive the direction of species displacement in two invasive species of leafminer fly? PLoS ONE 9, e98761.CrossRefGoogle ScholarPubMed
Wang, HH, Rreitz, S, Wang, LX, Wang, SY, Xue, LI and Lei, ZR (2014b) The mRNA expression profiles of five heat shock protein genes from Frankliniella occidentalis at different stages and their responses to temperatures and insecticides. Journal of Integrative Agriculture 13, 2196–2210.CrossRefGoogle Scholar
Wen, JZ, Wang, Y and Lei, ZR (1996) New record of Liriomyza sativae Blanchard (Diptera: Agromyzidae) from China. Entomotaxonomia 18, 311–312.Google Scholar
Wen, JZ, Lei, ZR and Wang, Y (1998) Survey of Liriomyza huidobrensis in Yunnan Province and Guizhou Province, China. Plant Protection 24, 18–20.Google Scholar
Yao, J, Rotenberg, D, Afsharifar, A, Barandoc-Alviar, K and Whitfield, AE (2013) Development of RNAi methods for Peregrinus maidis, the corn planthopper. PLoS ONE 8, e70243.10.1371/journal.pone.0070243CrossRefGoogle ScholarPubMed
Yu, N, Christiaens, O, Liu, J, Niu, J, Cappelle, K, Caccia, S, Huvenne, H and Smagghe, G (2013) Delivery of dsRNA for RNAi in insects: an overview and future directions. Insect Science 20, 4–14.10.1111/j.1744-7917.2012.01534.xCrossRefGoogle ScholarPubMed
Yuan, JW, Song, HX, Chang, YW, Yang, F, Xie, HF, Gong, WR and Du, YZ (2022) Identification, expression analysis and functional verification of two genes encoding small heat shock proteins in the western flower thrips, Frankliniella occidentalis (Pergande). International Journal of Biological Macromolecules 211, 74–84.10.1016/j.ijbiomac.2022.05.056CrossRefGoogle ScholarPubMed
Zhang, Y, Liu, Y, Guo, X, Li, Y, Gao, H, Guo, X and Xu, B (2014) sHsp22.6, an intronless small heat shock protein gene, is involved in stress defence and development in Apis cerana cerana. Insect Biochemistry and Molecular Biology 53, 1–12.10.1016/j.ibmb.2014.06.007CrossRefGoogle ScholarPubMed
Zhang, H, Li, H, Guan, R and Miao, X (2015) Lepidopteran insect species-specific, broad-spectrum, and systemic RNA interference by spraying dsRNA on larvae. Entomologia Experimentalis et Applicata 155, 218–228.10.1111/eea.12300CrossRefGoogle Scholar
Zhao, L and Jones, WA (2012) Expression of heat shock protein genes in insect stress responses. Invertebrate Survival Journal 9, 93–101.Google Scholar
Figure 0

Table 1. Primers used in recombinant protein amplification, dsRNA synthesis, and real-time quantitative PCR

Figure 1

Figure 1. Relative expression levels of LtHsp20.8 under high-temperature treatments. The relative level of Hsp expression represented the fold increase as compared with the expression in controls. (a) Relative expression levels for pupae; (b) relative expression levels for adults. The data were denoted as mean ± SE. One-way analysis of variance (ANOVA) was used to analyse the relative expression levels of Hsp20.8 under high-temperature treatments. For the ANOVA, data were tested for homogeneity of variances and normality. Different lowercase letters indicate significant differences among different temperature treatments. Tukey's multiple range test was used for pairwise comparison for mean separation (P < 0.05).

Figure 2

Figure 2. Recombinant LtHSP20.8 protein was (a) heterologously expressed in Escherichia coli and (b) verified by Western blotting. ‘pET-28a’ represents the empty vector. The arrowheads indicate the position of LtHSP20.8.

Figure 3

Figure 3. LtHSP20.8 displays protective effect against heat stress. Escherichia coli cells containing pET-28a-LtHSP20.8 plasmid and pET-28a empty vector were grown in medium under heat stress (45°C). (a) The growth curve of the bacteria was recorded every hour. (b) After a 6 h culture under heat stress, E. coli cells with or without overexpressing LtHSP20.8 were spread on LB agar plates, and grown at 37°C overnight. (c) The number of bacteria colony-forming units (CFUs) on the LB agar plates were counted. Data are means ± SE. ‘*’ denotes a significant difference between two groups (Student's t test, P < 0.05).

Figure 4

Figure 4. Knockdown of LtHsp20.8 by RNA interference and its effect on heat tolerance in adult stage. (a) Injection of dsRNA of LtHsp20.8 significantly reduced the expression level of LtHsp20.8 compared to the flies injected with dsRNA of green fluorescent protein (dsGFP) under heat stress. (b) Mortality of dsLtHsp20.8-injected and dsGFP-injected flies exposed to heat stress. Data are presented as means ± SE. ‘*’ indicate a significant difference between two groups (Student's t test, P < 0.05).

Figure 5

Figure 5. Knockdown of LtHsp20.8 by RNA interference and its effect on heat tolerance in pupae stage. (a) Immersion of dsRNA of LtHsp20.8 significantly reduced the expression level of LtHsp20.8 compared to the flies immersed with dsRNA of green fluorescent protein (dsGFP) under heat stress. (b) Mortality of ds LtHsp20.8-immersed and dsGFP-immersed flies exposed to heat stress. Data are presented as means ± SE. ‘*’ indicate a significant difference between two groups (Student's t test, P < 0.05).