To the Editor—Pseudomonas aeruginosa is one of the most notorious bacteria isolated from nosocomial infections. The growing threat of antimicrobial resistance in P. aeruginosa relies on its intrinsic resistance as well as on the transferable resistance determinants that further reduce their spectrum of susceptibility. Surveillance by hospitals to track the emergence of newer strains of P. aeruginosa is important to prevent its outbreak. In the present study, a total of 207 nonduplicate Pseudomonas isolates were collected over a period of 2 years (2013–2015) from various clinical samples of admitted patients (eg, pus, urine, wounds, and burns). The susceptibility of these isolates was tested against antimicrobial agents according to the Clinical and Laboratory Standards Institute (CLSI) broth microdilution procedure and interpretation criteria. 1 Among these isolates, 26 showed resistance to the following antibiotics: cefepime (89%), ceftriaxone (54%) gentamicin (79%), netillin (39%), ciprofloxacin (59%), and olfloxacin (34%). Based on the restriction pattern of 16S rRNA gene (Msp1 and Hha1), these 26 isolates were divided into 9 strains of P. aeruginosa. Among these 9 strains, 67% showed elevated minimum inhibitory concentrations (MICs) for imipenem (MIC, ≥10 μg/ml) and meropenem (MIC, ≥30 μg/ml). In a few studies from India, the rate of carbapenem resistance in P. aeruginosa isolates has been reported to vary from 12% to 43%.Reference Gladstone, Rajendran and Brahmadathan 2 , Reference Varaiya, Kulkarni, Bhalekar and Dogra 3 PCR amplification with NDM-1 primers (forward: CTCGCACCGAATGTCTGGC and reverse: GCGGCGTAGTGCTCAGTGTC) showed amplification in all the carbapenemase producers. The high prevalence rate of carbapenemase producers could be linked to poor control of antibiotic usage in India.Reference Kotwani and Holloway 4 Tigecycline, which was approved by the Food and Drug Administration in 2005, and the “old” antibiotic colistin are among the remaining treatment options for these difficult-to-treat infections.Reference Falagas and Kopterides 5 Among the carbapenem-resistant P. aeruginosa strains, 42% and 35% showed resistance to tigecycline (16–50 mg/L) and colistin (16–500 mg/L), respectively (Figure 1). Among these isolates, 2 (M-30 and R-32) showed resistance to all the last-resort antibiotics tested (ie, imipenem, meropenem, colistin, and tigecycline). This is the first study from India that has reported the emergence of a ‘superbug’ P. aeruginosa that is resistant to last-resort antibiotics.
FIGURE 1 Resistance pattern of P. aeruginosa to last-resort antibiotics.
Due to lack of stringent measures, almost all antimicrobial agents are available to both public and private-sector outpatients in India. Decades of overuse and misuse of antibiotics by both the public and clinicians has led to the evolution of these superbugs. A decline in the development of new antimicrobial agents and the simultaneous increase in resistance to available treatment options pose a threat to the successful treatment of infections caused by these notorious superbugs. Unless we continue to search fervently for solutions to this problem, we will soon face a time when mortality is caused by common infections.
ACKNOWLEDGMENTS
The author is thankful to Dr. E. Subudhi, Siksha ‘O’ Anusandhan University, Bhubaneswar, Odisha, India and Dr. Dinesh Goyal, Shiv Astha Clinic, Haryana, India for kindly providing the samples. Ethical approval was not required.
Financial support. This research was partly supported by SERB, Department of Science & Technology, New Delhi, India.
Potential conflicts of interest. The author reports no conflicts of interest relevant to this article.
