In 1983, the European Community (EC) agreed on a system for the conservation and management offishery resources which is based largely on the use of annual total allowable catch (TAC). Nevertheless, the state of many European stocks of demersal species has worsened since 1983. A review of TAC enforcement shows that landings have exceeded TACs to a limited extent for these resources. The contrary is observed for the stocks of pelagic species of which the state has improved although landings have frequently been larger than TACs. This double paradox generates a feeling of limited impact of the TAC system implemented by the EC. To investigate the reasons, the closeness between agreed TACs and scientific recommendations has been examined. The results show that the TAC decision process gives some preference to stability but attention is paid to the scientific recommendations. Finally, the lack of accuracy of predicted changes of fishing mortality in catch forecasts is found to have played a critical part in the failure of TACs to avoid the deteriorations of resources observed in EC waters. It leads to the conclusion that evaluation of risks in the TAC decision process and participation of actors of the fishing sector in risk management are important matters that cannot be avoided if one wants to improve the legitimacy of fisheries management and therefore its efficiency.

This study aims to evaluate the health status of Bizerta lagoon using a sentinel species, the Neogastropod Murex trunculus. Trace metal concentrations (Cd, Cu and Zn) in the foot and digestive gland, and biomarkers such as acetylcholinesterase (AChE), catalase (CAT) and glutathione transferase (GST) activities in the digestive gland, were determined in samples collected at four sites at different periods of the year. One site, in the North of the lagoon, is influenced by urban and industrial waste waters. Another, to the south, is located at the outfall of Ichkeul Lake. A third site is one that may be impacted by eutrophication processes, and the last, in the center of lagoon, is considered as less polluted. Temperature and salinity were simultaneously measured during the mollusc samplings. They varied greatly, from 13.5 °C and 30 psu in February to much higher values in summer-autumn: 30.7 °C and 37 psu. Metal concentrations were always higher in the digestive gland than in the foot. In the digestive gland, the lowest Cd and Cu concentrations were found in the center of the lagoon (mean ± standard deviation: 9.35 ± 0.78 µg Cd g−1 and 84.5 ± 15.3 µg Cu g−1) and no significant Zn variations were noted (682± 38 µg g−1) between sites. Metal concentrations in both types of tissue were higher in winter than in summer. AChE varied significantly among sites with high activities for individuals in the center of lagoon (15.4 ± 0.3 nmol min−1 mg-1 protein), whereas GST were low (12.2 ± 0.8 nmol min−1 mg−1 protein); CAT activities were low in this site 8.7 ± 0.5 µmol min-1 mg-1 protein. Season also had an influence on biomarkers, with low AChE in winter and rather low CAT and GST in summer. Principal component analysis showed that the center of lagoon can be considered as a reference site, whereas high chemical and biochemical responses were found in M. trunculus from other sites; particularly at the site which may be subject to eutrophication.

Mikrocytos mackini is the etiological agent of Denman Island disease, which causes significant mortalities in commercially important bivalve species, including the Pacific oyster, Crassostrea gigas. A close relative of M. mackini, Mikrocytos sp., was recently detected in oysters imported into France from Canada. In this study, we examined Pacific oysters from the northern coast of the Yellow Sea, China. Of the one hundred samples examined histologically, a microcell parasite was found in the tissues of four oysters. To identify whether the parasite was Mikrocytos sp., DNA was extracted from the oysters and polymerase chain reaction (PCR) amplifications were performed with primers (Mikrocytos-F and Mikrocytos-R), which yielded the expected 522 bp fragment. DNA sequencing of these products confirmed that they were identical to the corresponding 18S region of Mikrocytos sp. (100%) and had close similarity to M. mackini (89%). In situ hybridization (ISH) also was performed in this study, and the primer pair MM-like (CCTGTCCTATGTCGGGCAGG) hybridized with the Pacific oyster parasite. This is the first report of Mikrocytos sp. in the Pacific oyster from the coast of China. Although this study suggests a low prevalence of the parasite in China, its potential threat to aquaculture should be considered.

Factors influencing the spatial distribution of the bivalves Atactodea striata. Gafrarium tumidum and Anadara scapha were analysed on the south-west coast of New Caledonia, using a multivariate approach (correspondence analysis). A. striata is abundant on sandy beaches with a high coarse sand content. G. tumidum is preferentially distributed on substrates located close to the lower limit of neap tide and seems to be independent of sediment granulometry. A. scapha adults occur at lower bathymetric levels, with sediment composed of 40% medium, fine and very fine sand, and 30% very coarse and coarse sand. For this species, juvenile migration is suggested by the differential distribution of young and adults.

An effective treatment using cytochalasin B (1 mg CB/ml dimethylsulfoxyde in 1 litre of sea water) was developed to induce triploidy in the Manila clam Ruditapes philippinarum (Adams and Reeve). The percentage of induced triploidy was assessed by karyological examination of embryos and spat. The treatment was found to be optimal beween 20 to 35 minutes post-insemination exposure to CB, at 25 °C, and produced 75.8 ± 5.7% triploid embryos on the average over four experiments. Growth and survival of larvae to metamorphosis were recorded for two different rearings each split into two replicates. Both larval rearings showed similar survival up to settlement: 19.3 and 27.0%, on average over two replicates, in the treated batches relative to the controls. Mean shell length of treated larvae was significantly smaller than that of the controls in one of the larval rearings, where mortality of triploids relative to diploids within the treated group was low (21.0%). No significant differences in shell length were observed in the other trial where a high rate of differential mortality (64.5%) was recorded.

A wide spectrum of fish hosts in the Gulf of Guinea was examined for infestation with trypanorhynchid cestodes. A total of 1341 specimens belonging to 45 species were examined. The following 9 trypanorhynchid species were identified: Callitetrarhynchus gracilis, Grillotia perelica, Nybelinia sp., Otobothrium cysticum, O. dipsacum, Otobothrium sp., Poecilancistrum caryophyllum, Ptero-bothrium sp. and one unidentified species. The pattern of occurrence of Callitetrarhynchus gracilis has been used to draw conclusions on a possible 4-host life cycle of the species, involving two obligatory teleost host fish species, small clupeids and large predatory fish. The most abundant parasite was O. cysticum which was found in 8 host fishes. In general most other species occurred in one host fish species only. The study confirms the predominance of otobothriid cestodes in the parasite fauna of tropical and subtropical teleost fish species. Since only Pseudotolithus senegalensis and Stromateus fiatola harboured flesh infestations, trypanorhynchids do not pose serious dangers to the marketability of most commercially important fish species in the area. The method of scanning electron microscopy was used to clarify the details of hooklet arrangement on the tentacular armature of some species for the first time.

Depuis une quinzaine d’années le développement despêcheries artisanales des pays insulaires est basé sur la pêche desgrands pélagiques à partir de l’introduction d’une innovationmajeure, à savoir l’immersion de dispositifs de concentration de poissons(DCP ancrés). Face à cet engouement récent et aux résultatstrès mitigés, voire aux échecs, souvent observés,l’article propose une démarche méthodologiqued’élaboration d’un cadre d’évaluation permettant unclassement de la diversité et complexité des transformations induites parl’introduction des DCP et une estimation de la durabilité de leurintégration. La notion de durabilité intègre ici des objectifs àla fois écologiques quant à la conservation de la ressource etsocioéconomiques en termes de maîtrise et d’acceptation d’uneinnovation devant favoriser l’évolution du système. Cette analyseest effectuée en croisant plusieurs points de vue disciplinaires –biologique, géographique, économique et sociologique – et encomparant différentes expériences relevant de contextes et decommunautés de pêcheurs variés. Le cadre d’évaluation secompose d’une série de 21 indicateurs de nature biologique, technique,économique et sociale. Une illustration est proposée à partir de troisexemples représentatifs de la diversité des situations : LaRéunion, les Comores et l’archipel du Vanuatu. Sur la base d’uneévaluation aux dires d’experts, chacun de ces critères faitl’objet d’une notation selon une échelle de 0 à 5 en fonctiondu caractère inexistant, incertain, notable ou pérenne des effetsobservés. Enfin dans un souci de d’opérationnalité etd’aide à la décision, une présentation graphique desynthèse est élaborée pour faciliter les comparaisons et identifierles points critiques.

Afin d'améliorer la formulation des aliments composés destinés à la croissance de Penaeus rannamei, nous avons étudié l'effet de l'incorporation de farine de soja et de farine de poisson sur la croissance, la survie, les caractéristiques de l'hépatopancréas et les enzymes de cette espèce. Quatre concentrations de farine de soja (5, 10, 20, 40 %), quatre concentrations de farine de poisson (0, 5, 15, 30 %) deux formes de farine de soja et trois farines de poissons différentes suivant leur origine géographique ont été successivement testées. La nourriture (10 % du poids initial) a été distribuée deux fois par jour (8-9 h et 19 h). Les rapports hépatosomatiques, les protéines, les protéases, les amylases et la trypsine ont été déterminés sur neuf individus par traitement. Les résultats montrent qu'une forte incorporation de farine de soja ou de farine de poisson a pour effet de diminuer la croissance des animaux. Cette diminution est liée à une baisse de l'ingestibilité des aliments. Les enzymes digestives ne sont pas affectées. Les résultats montrent par ailleurs que l'origine géographique d'une source de poisson et le traitement subi par la farine de soja et la farine de poisson d'autre part, n'affectent pas les performances zootechniques et les enzymes digestives. L'ensemble des résultats permet de conclure que l'incorporation de soja ou de farine de poisson dans l'aliment doit être réalisée à faible taux, et ce, uniquement dans le but de diversifier les sources de protéines.

This work studied some of the metabolic responses of Nephrops norvegicus to a progressive reduction in water oxygen tension (PwO2) at 12 °C. Experiments were designed to simulate water quality conditions that may occur during the trade of live crustaceans. Oxygen consumption rates and ammonia efflux rates were found to be constant over a wide range of PwO2 values (20.4-5.9 kPa). A similar result was found for the difference between post-branchial and pre-branchial oxygen concentrations (20.4-2.6 kPa), obtained from a separate experiment. Anaerobic pathways, however, were activated after PwO2 reached 6.3 kPa, as blood lactate and glucose concentrations increased from 1.24 ± 0.08 and 1.17 ± 0.19 (T0 values) to 10.55 ± 8.99 and 3.63 ± 0.89 mg · 100 mL−1 respectively. N. norvegicus was able to maintain blood pH levels at relatively constant values despite a drop in water pH levels and the accumulation of lactate observed at low PwO2. Heart rates also remained stable during PwO2 reductions, but scaphognathite beat rate increased considerably, probably as an attempt to maintain steady weight-specific oxygen consumption rates. N. norvegicus appeared to be well adapted to cope with progressive hypoxia as may occur during holding and transportation procedures.

Within the framework of the Chilean molluscan shellfish safety program, blooms of Alexandrium were detected in several aquaculture sites in northern Chile. An outbreak of Alexandrium was detected in May 2006 in Mejillones Bay. Wild and cultured phytoplankton and shellfish samples from this bloom were analyzed by high performance liquid chromatography with fluorescent detection (HPLC-FD). Neither phytoplankton net tows samples nor an Alexandrium culture started from the bloom were found to contain PSP toxins at detectable levels. The shellfish, however, showed the presence of C2, GTX2, GTX3 and dcGTX2. Two new PSP episodes were recorded in June 2006 in Guanaqueros and Tongoy Bays. In these instances, shellfish samples from the two bays were analyzed by mouse bioassay and HPLC-FD, showing PSP toxicities that ranged from 27 to 34 $\mu $ g STX eq 100 g−1 and a toxin profile mainly characterized by the presence of STX, GTX2 and GTX3. Differences between toxin profiles in Mejillones Bay and the two other locations suggest that, in the area, this kind of toxicity is probably produced by different regional populations or strains of the genus Alexandrium other than Alexandrium catenella, since the toxin profile and optimal environmental conditions for this species are noticeably different from those recorded in the proliferations from northern Chile. This paper therefore presents the first report of this kind of toxicity from an area between parallels 13°55'S and 33°5'S, comprising the subtropical zone of the southeastern Pacific Ocean. Results suggest that, as in the northern Pacific coastal area of America, PSP toxicity may be widely distributed on the southern Pacific coast.

Marine Protected Areas (MPA) are often contemplated as a tool for the sustainable management of exploited resources and ecosystem conservation. This paper proposes an approach to establish a statistical diagnostic of the effects of MPAs on fish assemblages, and define corresponding ecological indicators. This requires choosing relevant variables (abundance, diversity, demographic parameters ...) and appropriate statistical methods. The study was based on data from the Abore reef Reserve in New Caledonia. Two sets of methods: 1-inferential linear models (ANOVA, GLM); 2- Partial Least Squares (PLS) methods of regression, were used to test the effects of this MPA. PLS enabled us to test simultaneously within a model, density, species richness, biomass and mean size variables of fish community to retain the most sensitive and relevant ones. Habitat variability was also taken into account in these models. Species were grouped according to several criteria: 1- feeding habit; 2- taxonomy; 3- mobility; 4- adult size; 5- demographic strategy. No significant effect of the opening of the Abore reef to fishing was found for mobility. Feeding habit was the only criterion for which the results from the inferential models and PLS showed a significant effect of reserve status for all variables. Species richness, density, and to a lesser extent mean size, were sensitive to the removal of reserve status, but not biomass. Results from ANOVA and PLS regression were consistent but the latter allows a more holistic approach as it integrates all variables within a single model.

A model is used to explore whether local density-dependent recruitment relationships can be observed when considering a larger scale. A virtual population of spawners is tracked within an artificial environment composed of cells. Spawners can move from one cell to another on a spatial grid defined as a square lattice (lattice scale) made of 20 × 20 jointed hexagonal cells (local scale). Five spawner's behaviours are experimented successively: i) spawners stay in the same cell to spawn; ii) they move randomly towards one of the neighbouring cells; iii) they move towards the least populated neighbouring cell; iv) they move towards the most populated neighbouring cell; and v) they move randomly towards a neighbouring cell and then move towards the most populated neighbouring cell. When the migration of spawners is achieved, spawners reproduce only once, recruitment takes place and then they disappear. The recruitment is an event which occurs at a local scale: at the scale of the cell. Using Ricker's stock-recruitment relationship, in each cell the number of recruits is a function of the spawners. Random migrations and migrations towards the less populated cell allow a homogeneous distribution of the spawners throughout the lattice. Whereas in the three other cases, this distribution is not homogenised. The homogenisation of the lattice allows synchrony between local populations and then a stock-recruitment relationship is observable at the lattice scale. Simulations show that local density-dependence is not always detectable when considering large spatial scale. This result strengthens the idea that the choice of spatial scale is essential when studying stock-recruitment relationship.

Under low signal-to-noise conditions, measurements of the acoustic backscattering cross-section σbs depend upon the position of the target in the beam. Split- and dual-beam measurements of σbs increase as the target moves away from the acoustic axis, leading to substantial overestimates of acoustic size for off-axis targets. We show how this phenomenon can be largely explained by measurement error in split-beam estimates of position, and by the effect of a minimum voltage threshold. We demonstrate a two-step correction to remove most of the bias. First, smoothed estimates of position are used to obtain an improved estimate of the beam directivity effect for each echo. Second, the statistical bias induced by the minimum voltage threshold is estimated and subtracted.

Seasonal variability in the morphology of the digestive tubules was investigated by means of a morphometric procedure in a population of Littorina littorea (Mollusca, Gastropoda) collected from the Abra estuary (Bay of Biscay, Basque Country) at four different seasons September, December, May and July). Some biometric characteristics of the winkles were recorded throughout the study period. Size parameters did not change significantly but high values of flesh condition (wet weight of flesh in mg per wet shell weight in g) were recorded in December and the lowest values in May. The reproductive state was determined using a planimetric procedure to calculate the relative tissue volume of digestive gland, gonad and storage tissue in the visceral mass. The relative volume of the digestive gland was significantly reduced in May. Gonad tissue volumes were maximal in May and minimal in September. Reserve connective tissue reached a maximum value in September. The quantitative structure of the digestive tubules was also investigated. The following five parameters were used to quantify digestive tubule morphology: mean epithelial thickness (MET), mean diverticular radius (MDR), mean luminal radius (MLR), MLR/MET ratio and MET/MDR ratio. The seasonal changes in the tissue composition of the visceral mass do not affect significantly any of these parameters. Thus, reserve storage/consumption and gamete development did not appear to affect the morphology of the digestive tubules in winkles. Reduced MET and MET/MDR values and augmented MLR/MET values were, however, observed at the breeding-spawning period. Such changes resemble a general stress response which might be related to the high metabolic cost of this phase of the reproductive cycle.

The European, native or flat oyster, Ostrea edulis, has been the subject of human-mediated translocation and aquaculture in Europe for centuries and may have diluted or masked natural population genetic structure. Samples of O. edulis from 10 sites in Scotland and The Netherlands, Brittany and Norway were collected and genotyped at up to six microsatellite loci. Numbers of alleles and heterozygosity per locus were high in all populations and were consistent with previous microsatellite studies. There is no evidence that extensive traditional oyster aquaculture has led to loss of allelelic diversity. Deficiencies of heterozygotes against Hardy-Weinberg predictions were common and were probably mainly due to the presence of null alleles. Overall, population differentiation (F st = 0.05) was estimated to be higher than previous studies and could be resolved into four main genetic groups (1) Norway, (2) The Netherlands and Brittany, (3) Scotland apart from (4) Skye. The genetic distinctness of Norway oysters agrees with previous findings. The distinctiveness of the Skye population could be partly due to an artefact of small sample sizes and partly due to the founder effect of importation of Brittany oysters in the 1950s. Further studies are required to ascertain whether the Skye population may be deserving of special conservation status. The results suggest that human aquaculture activities over recent centuries have probably diluted any original local genetic differentiation within Scotland, but that potentially important genetic differentiation still exists at the wider scale across Europe

A population of leaping grey mullet Liza saliens was studied in order to test whether growth rates decrease in summer owing to a reduction in food quality. A total of 330 juveniles of the 2-year age group were collected for measuring monthly changes in standard length, total weight, length growth rate and weight growth rate. Another 160 fish of the same age were caught monthly in February, April, August and November to measure food quality and calculate energy intake. Food quality changed as predicted. The organic matter content of the diet on a dry matter basis was 9.7% in April, 7.9% in August and 11.7% in November. The protein content of the diet on a dry matter basis was 9.0% in April, 6.4% in August and 9.3% in November. The carbohydrate content of the diet on a dry matter basis was 0.6% in April, 0.7% in August and 1.8% in November. The lipid content of the diet on a dry matter basis was 0.2% in April, 0.2% in August and 0.6% in November. The energy content of the diet was 2.63 kJ·g−1 in April, 2.21 kJ·g−1 in August and 3.13 kJ·g−1 in November. All the analysed mullet stomachs were empty in February, which suggests that they starve in winter. Daily rations increased when food quality decreased (4% of body weight in April, 6% in August and 1.4% in November). This allowed mullet to show high growth rates from June to August and to overcome a possible food limitation in the warm season. However, we do not know whether they would have grown even faster if food with a higher quality had been available.

Recruitment variability is commonly attributed to variation in spawning stock size and environmental variability. Here, the abundance of Loligo forbesi in the English Channel was estimated using cohort analysis. Environmental and adult biomass effects on recruitment variation were then tested. A stochastic length-age key was included in the cohort analysis, considering inter-individual variability in age at length. The number of recruits and parental stock biomass per monthly age-class were computed for a series of 13 fishing seasons (1989-2002). Recruitment was examined in relation to adult biomass and environmental parameters (sea surface temperature, SST, and the North Atlantic Oscillation, NAO) at the time of hatching. Recruits were approximately 7 months old and recruitment for each annual cohort occurred between April and August. Squid bigger than the length at maturity were assumed to be spawners. In the spawning season (September December), spawners were 11–13 months old. Parametric stock-recruitment curves (Ricker, Beverton and Holt, Shepherd, etc.) fitted poorly, while SST was negatively correlated with recruitment in a simple linear model. Recruitment was unrelated to NAO. A model combining SST and adult biomass showed that recruitment is probably density-dependent when stock size is high, and negatively correlated with temperature. The study did not indicate obvious recruitment overfishing in the English Channel L. forbesi population.

The main purpose of this study was to establish the pattern of variability of some hemato-immunological parameters in the mangrove oyster, Crassostrea rhizophorae, from 3 different environmental conditions in Santa Catarina Island: two natural habitats (mangrove and rocks of the coastal bay) and one oyster culture station. The water quality was adequate in all localities. The animals were collected seasonally over a period of one year (n = 30, per locality). The oyster hemolymph comprised two basic cell populations, hyaline (HH) and granular hemocytes (GH). Both cell populations contained carbohydrates and glycogen in their cytoplasm (periodic acid Schiff reaction, PAS staining) and the occurrence of lysosomes was suggested by the detection of acid phosphatase (Gomori's method). Both hemocyte populations were able of phagocytosis of zymosan particles in vitro and producing cytotoxic molecules, such as the superoxide anions (nitroblue-tetrazolium, NBT reduction). The oyster hemograms significantly differed in the different habitats and also among seasons. The total circulating hemocyte counts (THC) and the percentage of GH in the mangrove and rock oysters always differed from each other, but not from those of the cultured oysters. The highest THC and the lowest percentage of GH were always found in summer. The total plasma protein concentration (PC) exhibited a similar seasonal pattern in all oyster populations, with a marked decrease in spring. The PC of the cultured oysters was almost always significantly lower than that of the other oyster populations. The plasma agglutinating titer was higher in the cultured oysters regardless of season. The histological organization of the oyster digestive gland and gills was basically similar to that of other oyster species. Their structural aspect did not show any detectable alteration, corroborating that the oysters were in good health. The results of this study will serve as a basis for further analyses on the monitoring of C. rhizophorae health status and environmental quality in different aquatic habitats.

Gametogenic cycle, gross biochemical composition, condition indices and soft tissuecaloric value of the brown mussel Perna perna were investigated in thecoastal waters of the Gulf of Aden over ten months, to delineate ecophysiologicalperformance of the bivalve. The timing of reproductive activity and seasonal variations ofphysiological features appear to depend on interaction of environmental (exogenous) andinternal (endogenous) factors. Two major spawning events occurred during seasonal monsoonsi.e. in late summer (SW monsoon, August-September) and early spring (NW monsoon,February-March), although these differed considerably in relative intensity and the extentof the resulting changes in physiology and body weight. The summer breeding, which wascorrelated with low water temperature and abundant food, exerted little effect onbiochemical constituents, indicating protracted and portioned spawning. Reserve stores(lipids, carbohydrates and proteins) accumulated gradually in the cooler inter-monsoonperiod of gametogenic quiescence, to provide energy for periods of natural nutritionalstress when water temperature increased and primary production diminished. The secondspawning in spring was accompanied by a substantial decrease in lipids, carbohydrates andcondition indices of the mussels probably due to the release of nutrient-rich gametes inadaptive response to lower food availability in the environment. High reproductive effortpresumably induced increased mortality of females, which were strongly outnumbered bymales at a ratio of 1.8:1.0. Caloric value of this mussel falls within a range typical formussel species in other subtropical areas, highlighting the importance of Pernaperna as a local food resource and its potential suitability foraquaculture.