Lc. paracasei is a homofermentative lactic acid bacterium that is commonly used as an adjunct starter in dairy fermentations. This species contributes to flavour development and is a potential probiotic candidate in fermented dairy products (Mercanti et al., Reference Mercanti, Rousseau, Capra, Quiberoni, Tremblay, Labrie and Moineau2016). The development of a robust starter culture for industrial application is a rigorous process involving the characterization of its technological and functional attributes along with an assessment of its resilience to various threats in the nonsterile environment. Dairy effluents are potent sources of virulent phages that can infect starter cultures. The presence of phage-sensitive bacteria in starters could trigger phage multiplication and produce lytic phages to a significant level, irrespective of their initial low concentration. Such phage attack delays or even puts a complete halt on fermentation, leading to inferior quality products. Bacteriophages attacking lactic acid bacteria are gaining attention as the knowledge of the host phage interaction is essential for effectively tackling the problems of starter failure (Sunthornthummas et al., Reference Sunthornthummas, Doi, Rangsiruji, Sarawaneeyaruk and Pringsulaka2017). This study aimed to screen dairy effluents for the presence of lytic phages infecting the potential flavour-producing strains of Lc paracasei.
Materials and methods
Bacterial culture and cultivation media
Three indigenous Lc. paracasei strains isolated from household dahi samples of Kerala were used for the study. The details of strains (online Supplementary Table S1) and media for propagation of host and bacteriophage are given in the Supplementary File.
Identification of Lc. paracasei strains
Lc. paracasei strains were identified using 16S rRNA gene sequencing. The 16S rRNA gene was amplified using the universal primers, namely forward primer 27f (5′ AGAGTTTGATCCTGGCTCAG3′) and reverse primer 1492r (5′ GGTTACCTTGTTACGACTT 3′). The PCR conditions and sequencing details are given in the online Supplementary File. The sequences were compared to the GenBank database using the Basic Local Alignment Search Tool (BLAST).
RAPD analysis of Lc. paracasei strains was performed using random primer OPA-11, Operon Technologies, Alameda, CA (CAATCGCCGT). The phylogenetic tree was constructed using GelJ Version.2 Software. Pearson correlation was used as a similarity method and linkage was carried out with UPGMA with a tolerance of 10%.
Phage isolation and enrichment
Dairy effluent samples from a local milk processing unit were collected in sterile bottles and transported at 4°C to the laboratory for analysis. 50 ml of pooled sample was centrifuged at 4000 g for 10 min at 4°C. The supernatant was filtered through a 0.45 μm pore size mixed cellulose esters membrane syringe filter (Merck Millipore Ltd., Cork, Ireland) and stored at 4°C for further analysis (Feyereisen et al., Reference Feyereisen, Mahony, Lugli, Ventura, Neve, Franz, Noben, O'Sullivan and Van Sinderen2019). The filtrate was then screened for the presence of bacteriophages by multiple host enrichment method with modification for Lc. paracasei host whose details are given in the Supplementary File (and see Vaiyapuri et al. Reference Vaiyapuri, Raveendran, George, Gundubilli, Sivam, Krishnan, George, Mothadaka, Nagarajarao and Badireddy2021).
Phage detection and enumeration
Spot assay was used as the preliminary screening test for the detection of phages. Enumeration of phages was done by plaque assay using the double-layer agar plate method (Feyereisen et al., Reference Feyereisen, Mahony, Lugli, Ventura, Neve, Franz, Noben, O'Sullivan and Van Sinderen2019).
Phage DNA isolation, library construction and sequencing
Phage DNA was extracted from the filtered stock lysates according to a standard phenol/chloroform method (Moineau et al., Reference Moineau, Pandian and Klaenhammer1994). The sequencing of the phage genome was done at OmicGen Lifesciences Pvt Ltd, Ernakulam, India. Sequencing libraries were constructed using the NEB Ultra DNA kit (NEB, USA) according to the manufacturer's instructions for library preparation. The qualified library was used for sequencing. The library normalization, pooling and sequencing were done as per Kot et al. Reference Kot, Vogensen, Sørensen and Hansen2014. The genomes were sequenced as a part of a flow cell on the Illumina MiSeq platform and the pre-processed reads were de novo assembled using SPAdes (v3.13.1).
Genomic data availability
Assembled and annotated sequence of Lacticaseibacillus paracasei phage was submitted to www.ncbi.nlm.nih.gov GenBank under accession number MZ672003. The accession numbers of Lc paracasei strains are given in online Supplementary Table S1.
Results and discussion
Based on the 16S rRNA gene sequences of length 1465 bp, the strains were identified as Lc.paracasei. The assembled sequences were deposited at NCBI GenBank database with accession number as shown in online Supplementary Table S1. RAPD analysis using the random primer OPA-11 revealed Lc.paracasei ADMH7 is significantly different from the other two strains and the other two are dissimilar at 10% level. The dendrogram and the RAPD patterns are given in Figure 1. After the enrichment of the effluent sample in the presence of three Lc. paracasei strains only one strain (Lc. paracasei ADMT 26) was found to be sensitive to the phage present in the effluent (Fig. 2a). The other two strains Lc. paracasei ADMH7 and Lc. paracasei ADMH13 were found to be resistant. The genetic variation of these strains revealed during RAPD analysis supports the difference in phage sensitivity. This phage lysing the strain Lc. paracasei ADMT 26 was designated as phi2ADMT26 and produced plaques with diameters 1–2 mm Figure 2b. After serial dilution, an average plaque count of 1 × 106PFU/ml was obtained. The fastq quality information of the phage Lphi2ADMT26 is given in Table 1. The largest contig, having a length of 3781 bp, was extracted and BLAST annotated. The blast annotation showed 86.05% identity with complete genomic sequence of the temperate bacteriophage (Accession number NC_048680) isolated from Lactobacillus casei, designated as Lactobacillus phage LJ belonging to Siphoviridae family with 2e-81 E-value and 7% query coverage according to the nucleotide homology. Assembled and annotated genome of Lacticaseibacillus paracasei phage was submitted to GenBank under accession number MZ672003.
Figure 1. RAPD patterns and dendrogram of Lc. paracasei strains using the random Primer OPA-11. Lane-1 Ladder-100 bp; Lane 3- Lc. paracasei ADMH7; Lane 5- Lc. paracasei ADMH13; Lane 7 Lc. paracasei ADMT26.
Figure 2. Plaques of Lphi2ADMT26 phage on Lc. paracasei ADMT26 lawn. (a) A clear zone of lysis was observed for ADMT 26 on spot assay. No zones were observed for ADMH 13 and ADMH 7 (b) Clear plaques were observed after double-layer agar plating of enriched phages.
Table 1. The fastq quality information of the phage Lphi2ADMT26
Bacteriophages are the biological entities that are present in the ecosystems where bacteria are present, including man-made ecosystems like dairy fermentation vats and dairy effluents (Marcó et al., Reference Marcó, Moineau and Quiberoni2012). Lc. paracasei is one of the species that is usually isolated from artisanal fermented milk and has been found to have good technological properties like flavour production and, potentially, health-promoting effects (Bengoa et al., Reference Bengoa, Dardis, Garrote and Abraham2021). Many of the small-scale dairy units that venture into fermented milk product manufacturing in India are unaware of the consequences of phage attacks and are not sufficiently concerned about the proper disposal of effluent. Lacticaseibacillus phage Lphi2ADMT26 in this study is the first Lc. paracasei bacteriophage isolated from dairy effluents in India. The presence of Lb. paracasei phage ΦT25 was detected in abnormal fermented milk formed in a fermented milk factory in Thailand, and also belonged to the Siphoviridae family (Sunthornthummas et al., Reference Sunthornthummas, Doi, Rangsiruji, Sarawaneeyaruk and Pringsulaka2017). The presence of lytic phages affecting technologically relevant strains can limit their application in the food industry. The commonly used method in India for tackling phage-related problems in dairy fermentation is starter rotation together with sanitation by chemical and thermal treatments. Adoption of starter rotation without the proper knowledge of phage presence in the environment can ultimately create an ideal environment for the build-up of phages. The virulent nature of phages along with their increased resistance to thermal and chemical treatments necessitates early detection and continuous monitoring. (Mahony et al., Reference Mahony, Murphy and van Sinderen2012). The result of the present study highlights bacteriophage screening of starter culture collection as a good choice for use in industrial dairy fermentation to get consistent quality products.
In conclusion, we have characterized bacteriophage sensitivity of the dairy starter culture species, Lc. paracasei. The phage-resistant strains that we identified can be used effectively as functional starters in the manufacture of fermented milk products. As the study of phages affecting potential starters like Lc. paracasei is still in its infancy in India, screening of phage samples from other niches in dairy premises is also necessary to explore their mode of action and to devise evolutionary strategies.
Supplementary material
The supplementary material for this article can be found at https://doi.org/10.1017/S0022029923000274.
Acknowledgement
The authors acknowledge Kerala Veterinary and Animal Sciences University for providing research funding for PhD work of the first author. The authors also acknowledge Dr. Jennifer Mahony, Professor, Molecular Food Microbiology, University of Cork, Ireland for technical support.
