Hostname: page-component-586b7cd67f-rcrh6 Total loading time: 0 Render date: 2024-11-28T16:20:09.638Z Has data issue: false hasContentIssue false
  • English
  • Français

A new needle nematode, Longidorus zanjanensis sp. nov. (Nematoda: Longidoridae) from north-western Iran

Published online by Cambridge University Press:  07 November 2023

M. Asgari ,
A. Eskandari Open the ORCID record for A. Eskandari [Opens in a new window] ,
P. Castillo  and
J.E. Palomares-Rius Open the ORCID record for J.E. Palomares-Rius [Opens in a new window]
M. Asgari
Affiliation:
Department of Plant Protection, Faculty of Agriculture, University of Zanjan, 45371-38791, Zanjan, Iran
A. Eskandari*
Affiliation:
Department of Plant Protection, Faculty of Agriculture, University of Zanjan, 45371-38791, Zanjan, Iran
P. Castillo
Affiliation:
Institute for Sustainable Agriculture (IAS), Spanish National Research Council (CSIC), Avenida Menéndez Pidal s/n, Campus de Excelencia Internacional Agroalimentario, ceiA3, CSIC, Córdoba, Spain
J.E. Palomares-Rius*
Affiliation:
Institute for Sustainable Agriculture (IAS), Spanish National Research Council (CSIC), Avenida Menéndez Pidal s/n, Campus de Excelencia Internacional Agroalimentario, ceiA3, CSIC, Córdoba, Spain
*
Corresponding authors: A. Eskandari and J.E. Palomares-Rius; Emails: [email protected]; [email protected]
Corresponding authors: A. Eskandari and J.E. Palomares-Rius; Emails: [email protected]; [email protected]
Rights & Permissions [Opens in a new window]

Abstract

During a survey of soil nematodes in 2022, a new species of the genus Longidorus, described here as Longidorus zanjanensis sp. nov., was discovered in the rhizosphere of Astragalus sp. in Zanjan Province, Iran. The new needle nematode is described and illustrated based on morphological, morphometric, and molecular traits. Further, its females are characterized by having a long body ranging 5.6–7.7 mm long, lip region anteriorly flattened and almost continuous or slightly offset by a depression with body contour, ca 16.5–18.5 μm wide, amphidial fovea pouch-like without basal lobes, guiding ring at 35–41 μm distance from the anterior end, and an odontostyle and odontophore ranging 102–115 and 47–75 μm long, respectively. The pharyngeal bulb is 123–153 μm long, female reproductive system didelphic–amphidelphic containing sperm, vulva almost equatorial, located at 46.7–51.4% of body length, tail short, rounded to bluntly conoid, bearing two pairs of caudal pores and terminus widely rounded with distinct radial lines in hyaline region (39–50 μm long, c = 122.4–189.4, c’ = 0.6–0.8). Males are common, making up to 60% of the adults, and are functional, with spicules 68.0–80.0 μm long, as well as having 8–14 ventromedian copulatory supplements. All four juvenile life developmental stages were present, with the tail of first-stage juvenile conoid shape, dorso-ventrally curved with rounded terminus. The polytomous codes delimiting the new species are: A4-B3-C3-D3-E1-F34-G12-H1-I2-J1-K6. Morphologically, the new species comes close to eight known species of the genus, namely L. apulus, L. armeniacae, L. crassus, L. kheirii, L. soosanae, L. proximus, L. pauli, and L. ferrisi. The morphological differences between the new species and the aforementioned species are discussed. Molecular phylogenetic analyses based on D2-D3 of large subunit (LSU) and internal transcribed spacer 1 (ITS1) rRNA sequences indicate that Longidorus zanjanensis sp. nov. is closely related to L. hyrcanus, L. soosanae, and L. elongatus.

Keywords

new speciesphylogenytaxonomyAstragalus sp.Zanjan
Type
Research Paper
Information
Journal of Helminthology , Volume 97 , 2023 , e81
Creative Commons
Creative Common License - CCCreative Common License - BY
This is an Open Access article, distributed under the terms of the Creative Commons Attribution licence (http://creativecommons.org/licenses/by/4.0), which permits unrestricted re-use, distribution and reproduction, provided the original article is properly cited.
Copyright
© The Author(s), 2023. Published by Cambridge University Press

Introduction

Dorylaimida Pearse, Reference Pearse1942 is one of the most diverse orders in terms of number of species within the phylum Nematoda (Jairajpuri & Ahmad Reference Jairajpuri and Ahmad1992; Andrassy Reference Andrássy2009). The family Longidoridae Thorne, Reference Thorne1935 (Thorne Reference Thorne1935), inside Dorylaimida, includes obligate plant ectoparasitic species and is one of the most economically important nematode groups in agriculture. The importance of this group of nematodes lies not only in their polyphagy and cosmopolitan distribution but also their status as vectors of plant viruses that cause significant damage to a wide range of agricultural crops (Coomans Reference Coomans1996; Taylor & Brown Reference Taylor and Brown1997; Macfarlane Reference Macfarlane2003; Decraemer & Robbins Reference Decraemer and Robbins2007; Decraemer & Geraert Reference Decraemer, Geaert, Perry and Moens2013; Archidona-Yuste et al. Reference Archidona-Yuste, Navas-Cortés, Cantalapiedra-Navarrete, Palomares-Rius and Castillo2016a, Reference Archidona-Yuste, Navas-Cortés, Cantalapiedra-Navarrete, Palomares-Rius and Castillob, Reference Archidona-Yuste, Wiegand, Castillo and Navas-Cortés2019a). The family Longidoridae includes more than 500 species (Coomans et al. Reference Coomans, Huys, Heyns and Luc2001; Decraemer & Robbins Reference Decraemer and Robbins2007), where the needle nematodes of the genus Longidorus Micoletzky, Reference Micoletzky1922 are one of the most diverse genera of this family. This genus includes a number of long to very long body (2–12 mm) specimens with long stylet (80–260 μm). They are a polyphagous species of many plants including various agricultural crops, and they cause damage by direct feeding on root cells as well as by transmitting nepoviruses (nepoviruses are icosahedral, with a bipartite positive stranded RNA genome, wherein each RNA encodes as a single polyprotein). The genus Longidorus is a diverse group with more than 177 nominal species (Gutiérrez-Gutiérrez et al. Reference Gutiérrez-Gutiérrez, Teixeira Santos, Inácio, Eisenback and Mota2020; Clavero-Camacho et al. Reference Clavero-Camacho, Liébanas, Escuer, Cantalapiedra-Navarrete, Archidona-Yuste, Castillo and Palomares-Rius2021). Only 11 species (6.9%) (L. apulus Lamberti & Bleve-Zacheo, Reference Lamberti and Bleve-Zacheo1977; L. arthensis Brown et al., Reference Brown, Grunder, Hooper, Klingler and Kunz1994; L. attenuatus Hooper, Reference Hooper1961; L. caespiticola Hooper, Reference Hooper1961; L. diadecturus Eveleigh & Allen, Reference Eveleigh and Allen1982, L. elongatus (de Man, Reference De Man1876) Thorne & Swanger, Reference Thorne and Swanger1936; L. fasciatus Roca & Lamberti, Reference Roca and Lamberti1981; L. leptocephalus Hooper, Reference Hooper1961; L. macrosoma Hooper, Reference Hooper1961; L. martini Merny, Reference Merny1966, and L. profundorum Hooper, Reference Hooper1965) have been reported as virus vector transmitting seven nepoviruses (artichoke Italian latent virus, cherry rosette disease virus, tomato black ring virus, raspberry ringspot virus, Arabis mosaic virus, peach rosette mosaic virus, and mulberry ringspot virus) (Brown et al. Reference Brown, Lamberti, Taylor and Trudgill1988; Taylor & Brown Reference Taylor and Brown1997; Decraemer & Robbins Reference Decraemer and Robbins2007). These nematodes spend their entire life cycle in the rhizosphere, using their needle stylet to feed on the apical root cells, inducing galls in the tips and arresting root growth (Taylor & Brown Reference Taylor and Brown1997; Palomares-Rius et al. Reference Palomares-Rius, Escobar, Cabrera, Vovlas and Castillo2017). The morphological convergence and the existence of cryptic species in this genus make the accurate identification of species considerably more difficult (De Luca et al. Reference De Luca, Reyes, Grunder, Kunz, Agostinelli, De Giorgi and Lamberti2004; Gutiérrez-Gutiérrez et al. Reference Gutiérrez-Gutiérrez, Cantalapiedra-Navarrete, Montes-Borrego, Palomares-Rius and Castillo2013; Archidona-Yuste et al. Reference Archidona-Yuste, Navas-Cortés, Cantalapiedra-Navarrete, Palomares-Rius and Castillo2016b, Reference Archidona-Yuste, Cantalapiedra-Navarrete, Castillo and Palomares-Rius2019b). Consequently, morphological taxonomy could lead to underestimation of the diversity in the genus Longidorus as reported in other genera of plant-parasitic nematodes (Palomares-Rius et al. Reference Palomares-Rius, Cantalapiedra-Navarrete and Castillo2014; Archidona-Yuste et al. Reference Archidona-Yuste, Navas-Cortés, Cantalapiedra-Navarrete, Palomares-Rius and Castillo2016a, Reference Archidona-Yuste, Navas-Cortés, Cantalapiedra-Navarrete, Palomares-Rius and Castillob, Reference Archidona-Yuste, Navas-Cortés, Cantalapiedra-Navarrete, Palomares-Rius and Castilloc; Janssen et al. Reference Janssen, Karssen, Orlando, Subbotin and Bert2017). Therefore, accurate identification of Longidorus species is essential in establishing appropriate control measures and control strategies for preventing the spread of these nematodes. To date, 27 Longidorus species have been reported from Iran, including: L. aetnaeus Roca et al., Reference Roca, Lamberti, Agostinelli and Vinciguerra1986; L. africanus Merny, Reference Merny1966; L. apulus; L. armeniacae Bakhshi Amrei et al., Reference Bakhshi Amrei, Peneva, Rakhshandehroo and Pedram2022; L. artemisiae Rubtsova et al., Reference Rubtsova, Chizhov and Subbotin1999; L. behshahrensis Bakhshi Amrei et al., Reference Bakhshi Amrei, Peneva, Rakhshandehroo and Pedram2020; L. crassus Thorne, Reference Thorne1974; L. elongatus; L. euonymus Mali & Hooper, Reference Mali and Hooper1974; L. hyrcanus Mobasseri et al., Reference Mobasseri, Pourjam, Farashiani and Pedram2023; L. iranicus Sturhan & Barooti, Reference Sturhan and Barooti1983; L. kheirii Pedram et al., Reference Pedram, Niknam, Robbins, Ye and Karegar2008; L. leptocephalus; L. orientalis Loof, Reference Loof1982; L. paravineacola Ye & Robbins, Reference Ye and Robbins2003; L. perangustus Roshan-Bakhsh et al., Reference Roshan-Bakhsh, Pourjam and Pedram2016; L. persicus Esmaeili et al., Reference Esmaeili, Heydari, Archidona-Yuste, Castillo and Palomares-Rius2017; L. pisi Edward et al., Reference Edward, Misra and Singh1964; L. profundorum; L. protae Lamberti & Bleve-Zacheo, Reference Lamberti and Bleve-Zacheo1977; L. proximus Sturhan & Argo, Reference Sturhan and Argo1983; L. sabalanicus Asgari et al., Reference Asgari, Eskandari, Castillo and Palomares-Rius2022; L. soosanae Pour Ehtesham et al., Reference Pour Ehtesham, Pedram, Atighi and Jahanshahi Afshar2023; L. sturhani Rubtsova et al., Reference Rubtsova, Subbotin, Brown and Moens2001; L. tabrizicus Niknam et al., Reference Niknam, Pedram, Ghahremani Nejad, Ye, Robbins and Tanha Maafi2010, and L. vineacola Sturhan & Weischer, Reference Sturhan and Weischer1964. In a May 2022 survey, a population of an unidentified species of Longidorus was recovered from the rhizosphere of Astragalus sp. naturally growing in the mountains of the Anguran Protected Area, west Mahneshan, Zanjan province. Molecular approaches and phylogenetic studies in combination with morphometric characters are used as a taxonomic standard for species identification and delimitation, which is known as Integrative Taxonomy (Gutiérrez-Gutiérrez et al. Reference Gutiérrez-Gutiérrez, Cantalapiedra-Navarrete, Montes-Borrego, Palomares-Rius and Castillo2013; Peneva et al. Reference Peneva, Lazarova, De Luca and Brown2013; Archidona-Yuste et al. Reference Archidona-Yuste, Navas-Cortés, Cantalapiedra-Navarrete, Palomares-Rius and Castillo2016d). Our research aims to characterize this undescribed nematode species based on morphological characters integrated with molecular data and infer the phylogenetic relationships with the other species of genus Longidorus.

Materials and methods

Nematode population sampling, extraction, and morphological identification

About 100 soil samples were collected from the rhizosphere of different plants at a depth of 10–50 cm, in the Zanjan province, north-western Iran. Specimens of an unidentified Longidorus sp. nov. were obtained from the rhizosphere of Astragalus sp. in Zanjan province. Nematodes were extracted using the tray method (Whitehead & Hemming Reference Whitehead and Hemming1965), the magnesium sulphate (MgSO4) centrifugal flotation method (Coolen Reference Coolen, Lamberti and Taylor1979), and a modification of Cobb’s decanting and sieving method (Flegg Reference Flegg1967). Nematodes were handpicked under a stereomicroscope, killed by adding hot FPG (4:1:1, formaldehyde: propionic acid: glycerin) solution, transferred to anhydrous glycerine according to De Grisse (Reference De Grisse1969), and mounted on permanent glass slides to allow handling and observation. Morphometric values and photomicrographs were taken using a Dino-Eye digital eyepiece camera (Model AM7023, bundled with DinoCapture 2.0 software; AnMo Electronics Corporation, New Taipei City, Taiwan) attached to a Leitz Dialux 22 light microscope. Line drawings were first made using a drawing tube, then re-drawn and prepared for publication using CorelDRAW software version 16 (Corel Corp, Canada). Morphological comparisons were performed using the polytomous identification keys for the identification of Longidorus species (Chen et al. Reference Chen, Hooper, Loof and Xu1997; Loof & Chen Reference Loof and Chen1999) and with the descriptions of all other characterized species up to the present. The position of pharyngeal gland nuclei was calculated according to Loof & Coomans (Reference Loof and Coomans1972), and the juvenile developmental stages were identified according to Robbins et al. (Reference Robbins, Brown, Halbrendt and Vrain1995). All measurements were recorded in micrometres (μm), except for body length in millimetres (mm) and ratios. Ratios are defined in Jairajpuri & Ahmad (Reference Jairajpuri and Ahmad1992).

Molecular characterization

For the molecular phylogenetic studies, four live nematode specimens (two females and two juveniles) were selected. Each specimen was transferred to an Eppendorf tube containing 10 μl ddH2O, 8 μl lysis buffer (125 mM KCl, 25 mM Tris–Cl pH 8.3, 3.75 mM MgCl2, 2.5 mM DTT, 1.125% Tween 20, 0.025% gelatine), and 2 μl proteinase K (600 μg/ml), and crushed for 2 min with a micro-homogeniser (Subbotin et al. Reference Subbotin, Halford, Warry and Perry2000). The tubes were frozen at -80 °C (15 min), then incubated at 65 °C (1 h) and at 95 °C (10 min), consecutively. After centrifugation (1 min, 16,000 × g), 4 μl of extracted DNA were added to the polymerase chain reaction (PCR) mixture in a 0.2 ml Eppendorf tube containing: 20 μl 2 × Master mix (Amplicon, Odense, Denmark), 2 μl of each primer (10 pMol/μl), and 12 μl ddH2O, to a final volume of 40 μl. The D2-D3 expansion segments of 28S rRNA were amplified using forward D2A (5′–ACAAGTACCGTGAGGGAAAGTTG–3′) and reverse D3B (5′–TCGGAAGGAACCAGCTACTA–3′) primers (Nunn Reference Nunn1992). The ITS1 region was amplified using forward primer 18S (5′–TTGATTACGTCCCTGCCCTTT–3′) (Vrain et al. Reference Vrain, Wakarchuk, Levesque and Hamilton1992) and reverse primer rDNA1 5.8S (5′–ACGAGCCGAGTGATCCACCG–3′) (Cherry et al. Reference Cherry, Szalanski, Todd and Powers1997). PCR reactions were carried out in a DNA thermal cycler (Hybaid, Ashford, Middlesex, UK), and the amplification program was set as follows: initial denaturation at 94 °C for 10 min; followed by 35 cycles of denaturation at 94 °C for 30 s, annealing at 57 °C (LSU), 55 °C (ITS1) for 30 s, extension at 72 °C for 1 min; and finally, the elongation step at 72 °C for 6 min. The amplified PCR products were purified using ExoSAP-IT (Affimetrix, USB products), quantified using a Nanodrop spectrophotometer (Nanodrop Technologies, Wilmington, DE, USA), and used for direct sequencing in both directions using the primers referred to above. The resulting products were purified and run on a DNA multicapillary sequencer (Model 3130XL genetic analyser; Applied Biosystems, Foster City, CA, USA), using the BigDye Terminator Sequencing Kit v.3.1 (Applied Biosystems, Foster City, CA, USA) at the Stab Vida sequencing facilities (Caparica, Portugal). The newly obtained sequences were submitted to the GenBank database under the accession numbers OR509844-OR509847 for D2-D3 expansion segments of 28S rRNA and OR509848-OR509851 for ITS1 region.

Phylogenetic analyses

The newly obtained sequences of L. zanjanensis sp. nov. (D2-D3 expansion segments of 28S rRNA, and ITS1 rRNA) and other sequences of different Longidorus spp. from GenBank were used for phylogenetic analyses. ITS1 rRNA did not have enough similarity with other sequences deposited in the GenBank, and for this reason, sequence similarity comparisons were only made with the closest phylogenetically related species. Outgroup taxa for each dataset were chosen following previously published studies (He et al. Reference He, Subbotin, Rubtsova, Lamberti, Brown and Moens2005; Holterman et al. Reference Holterman, van der Wurff, van den Elsen, van Megen, Bongers, Holovachov, Bakker and Helder2006; Palomares-Rius et al. Reference Palomares-Rius, Subbotin, Landa, Vovlas and Castillo2008; Gutiérrez-Gutiérrez et al. Reference Gutiérrez-Gutiérrez, Cantalapiedra-Navarrete, Montes-Borrego, Palomares-Rius and Castillo2013; Archidona-Yuste et al. Reference Archidona-Yuste, Cantalapiedra-Navarrete, Castillo and Palomares-Rius2019b; Cai et al. Reference Cai, Archidona-Yuste, Cantalapiedra-Navarrete, Palomares-Rius and Castillo2020a, Reference Cai, Prior, Lawson, Cantalapiedra-Navarrete, Palomares-Rius, Castillo and Archidona-Yusteb). Multiple sequence alignments for each gene were made using the FFT-NS-2 algorithm of MAFFT V.7.450 (Katoh et al. Reference Katoh, Rozewicki and Yamada2019). Sequence alignments were visualized using BioEdit (Hall Reference Hall1999) and manually edited and trimmed of poorly aligned positions using a light filtering strategy (up to 20% of alignment positions), which has little impact on tree accuracy and may save some computation time, as suggested by Tan et al. (Reference Tan, Muffato, Ledergerber, Herrero, Goldman, Gil and Dessimoz2015). Phylogenetic analyses of the sequence datasets were based on Bayesian inference (BI) using MrBayes 3.1.2 (Ronquist & Huelsenbeck Reference Ronquist and Huelsenbeck2003). The best-fit model of DNA evolution was obtained using JModelTest V.2.1.7 (Darriba et al. Reference Darriba, Taboada, Doallo and Posada2012) with the Akaike Information Criterion (AIC). The best-fit model, base frequency, proportion of invariable sites, and gamma distribution shape parameters and substitution rates in the AIC were then used in MrBayes for the phylogenetic analyses. The general time-reversible model with invariable sites and a gamma-shaped distribution (GTR + I + G) for the D2-D3 segments of 28S rRNA and the general time-reversible model and a gamma-shaped distribution (GTR + G) for ITS1 rRNA were run with four chains for 4 × 106 generations, respectively. The Markov chains were sampled at intervals of 100 generations. Two runs were conducted for each analysis. After discarding burn-in samples of 30% and evaluating convergence, the remaining samples were retained for in-depth analyses. The topologies were used to generate a 50% majority-rule consensus tree. Posterior probabilities (PP) were given on appropriate clades. Trees from all analyses were visualised using FigTree software version 1.4.4 (Rambaut Reference Rambaut2018).

Results and Discussion

The integration of nematode morphology with the morphometric analysis and molecular data using ribosomal sequences allowed us to describe herein a new species of the genus as L. zanjanensis sp. nov.

Longidorus zanjanensis sp. nov.

Zoobank: urn:lsid:zoobank.org:act:7584860D-A994-495B-A5CD-5AE62DBA0AD6

Description

See Figures 1–4 and Table 1.

Figure 1. Line drawings of Longidorus zanjanensis sp. nov. A: Female reproductive system. B: Female anterior region. C: Female anterior region. D: Anterior end showing amphidial fovea. E, F: Female tail. G: Male posterior body region. H: J1 tail. I: J2 tail. J: J3 tail. K: J4 tail.

Table 1. Morphometrics of Longidorus zanjanensis sp. nov. from Zanjan, Iran. All measurements are in μm (except L, in mm) and in the form: mean ± standard deviation (range)

* Abbreviations: n = number of specimens on which measurements are based; L = overall body length; a = body length/greatest body diameter; b = body length/distance from anterior end to pharyngo-intestinal junction; c = body length/tail length; c’ = tail length/tail diameter at anus or cloaca; V = distance from body anterior end to vulva expressed as percentage (%) of the body length; T = distance from cloacal aperture to anterior end of testis expressed as percentage (%) of the body length.

Female. Body ventrally bent varying from J to G shape when heat-relaxed. Cuticle appearing smooth under light microscope; its thickness varies over the body, 4–5 μm at guiding ring level, to 3–4 μm at mid-body, 7–8 μm at anterior lip of anus, and 14–23 μm at tail end (the hyaline part of tail tip), and marked by very fine superficial transverse striae mainly in tail region. Lateral chord 23–30% of corresponding body diameter. Lip region anteriorly flattened, continuous with the adjacent body (Figures 1, 2). Amphidial fovea is pouch-like without lobes at base. Stylet guiding ring located at ca. two times lip region diameter from anterior end. Odontostyle long and narrow, approximately 1.9 times as long as odontophore (Figures 1, 2). Nerve ring surrounding the slender portion of the pharynx posterior to the odontophore base, located at 247–280 μm from anterior end. Pharynx dorylaimoid, anterior slender part flexible, posteriorly expanding to a muscular terminal bulb occupying about 24.1 ± 1.7 (20.7–27.4)% of the total pharynx (neck region).The dorsal gland nucleus (DN) smaller, at 26.1–36.4%, and the two ventrosublateral nuclei (S1N) at about the same level and at 51.0–61.5% of the pharyngeal bulb length (location of glands nuclei according to Loof & Coomans (Reference Loof and Coomans1972)). Cardia conoid to rounded, 5.0–7.0 μm long. Intestine with prerectum. The reproductive system didelphic–amphidelphic, with both branches almost equally developed, each branch 500–1100 μm long, with reflexed ovaries highly variable in length, anterior ovary (173–324 μm long), and posterior ovary (157–390 μm long). Oviducts slightly longer than ovaries. Uterus bipartite, quite variable in length, anterior uteri (230–276) μm long, and posterior uteri (208–286) μm long; sphincter well developed, between uterus and oviduct. Sperm commonly found in the uteri. Vagina 50–74 μm long or ca. 66% of corresponding body width; pars distalis 11–16 μm long, pars proximalis vaginae measuring 20–34 μm long; vulva a transverse slit. Prerectum variable in length, 3.9–11.4 times longer than anal body width and rectum simple, 0.8–0.1 times as long as tail length. Tail bearing two caudal pores, conoid, convex dorsally, and ventrally almost straight or slightly concave with rounded terminus.

Figure 2. Light micrographs of Longidorus zanjanensis sp. nov. (a–d) female anterior body regions showing odontostyle, odontophore, amphidial fovea, and guiding ring (arrowed); (e) detail of basal bulb showing dorsal gland and ventrosublateral nuclei (arrowed); (f-i) female tail; (j, k) male tail with details of spicules, guiding pieces of gubernaculum and ventromedian supplements (arrowed). Abbreviations: a = anus; af = amphidial fovea; gr = guiding ring; gp = guiding pieces of gubernaculum; odt = odontostyle; odp = odontophore; sp = spicule; vspl = ventromedian supplement. (Scale bars: 20 μm).

Male. Common (about 60% of the population) and functional. Similar to females in general morphology, except for the reproductive system and posterior end more ventrally curved Male genital reproductive system diorchic. Spicules arcuate, robust, about 1.5 times longer than tail length, lateral guiding piece more or less straight. Adanal supplements paired, preceded anteriorly by a row of 8–14 irregularly spaced ventromedian supplements. Tail bluntly conoid, dorsally convex and ventrally concave, terminus widely rounded, with distinct radial lines in hyaline region. Tail length almost equivalent to cloacal body width.

Juveniles. Morphologically similar to adults in most respects except for size and development of reproductive system. All juvenile developmental stages were detected and distinguished by relative lengths of body and functional and replacement odontostyle (Figure 4). J1 characterized by a conoid tail, dorso-ventrally curved with rounded terminus, and slight depression at hyaline region level, with a c´ ratio average of 2.3, odontostyle length ca. 66.3 μm, and shorter distance from anterior end to stylet guiding-ring than that in adult stages. For the rest of the juvenile stages (J2, J3, J4), the replacement odontostyle were located at some distance posterior to the odontophore base and morphology of tail were similar to females (bluntly conoid with a rounded terminus, dorsally convex and ventrally almost straight or slightly concave), becoming stouter after each moult (Figure 3).

Figure 3. Light micrographs of Longidorus zanjanensis sp. nov. (a–d) tails of J1, J2, J3, and J4. (Scale bars: a–d = 20 μm).

Figure 4. Relationship between body length and functional and replacement odontostyle length in all developmental juvenile life stages and mature adults of Longidorus zanjanensis sp. nov.

Diagnosis and relationships

Longidorus zanjanensis sp. nov. is characterised by a thick (a < 88) and long body (5.6–7.7 mm); lip region 16.5–18.5 μm wide and continuous with body contour; amphidial fovea pouch shaped, not bilobed, and extending about 1/2 part of oral aperture-guiding ring distance; relatively long odontostyle (102–115 μm); guiding ring located at 35.0–41.0 μm from anterior end; vulva located at 46.7–51.4% of body length; female tail short and bluntly conoid (39.0–50.0 μm long, c = 122.4–189.4, c’ = 0.6–0.8), with two pairs of caudal pores. Males with long spicules (68–80 μm) and 8–14 ventromedian supplements. Four developmental juvenile stages were identified, with the first stage juvenile with conoid tail (c’ = 2.1–2.5). According to the polytomous key by Chen et al. (Reference Chen, Hooper, Loof and Xu1997), supplement by Loof & Chen (Reference Loof and Chen1999), and the addition of some characters by Peneva et al. (Reference Peneva, Lazarova, De Luca and Brown2013), codes for the new species are: A4-B3-C3-D3-E1-F34-G12-H1-I2-J1-K6; and specific D2-D3 expansion segments of 28S rRNA, and ITS1 region (GenBank accession numbers: OR509844 for D2-D3 expansion segments of 28S rRNA and OR509848-OR509851 for ITS1 region).

According to the body and odontostyle length, shape of amphidial fovea, distance of guiding ring from anterior body end, lip region and tail shape, a and c’ ratios, and frequency of males, the new species is close to eight known Longidorus species, namely L. apulus; L. armeniacae; L. crassus; L. ferrisi Robbins et al., Reference Robbins, Ye and Pedram2009; L. kheirii; L. pauli Lamberti et al., Reference Lamberti, Molinari, De Luca, Agostinelli and Di Vito1999; L. proximus; and L. soosanae. In addition, L. zanjanensis sp. nov. is closely related molecularly to L. hyrcanus; L. elongatus; and also L. soosanae.

The new species differs from L. apulus by having a different amphidial fovea shape (pouch-like-shaped, not bilobed vs. symmetrically bilobed at base), a higher oral aperture to guiding ring distance (35.0–41.0 vs. 24.0–34.0 μm), lower a ratio (68.7–87.8 vs. 110–154), and longer spicule length (68.0–80.0 vs. 57.0 μm). From L. armeniacae, it differs by a higher oral aperture to guiding ring distance (35.0–41.0 vs. 29.0–35.0 μm), shorter spicule length (68.0–80.0 vs. 80.0–107 μm), and different tail shape in J1 (slender conical, without a digitate or subdigitate terminus vs. convex-conoid to conical, with a distinctly digitate terminus). It differs from L. crassus by having a longer body (5.6–7.7 vs. 5.0–6.0 mm), different amphidial fovea shape (pouch-like, not bilobed vs. symmetrically bilobed at base), wider lip region width (16.5–18.5 vs. 15 μm), higher oral aperture to guiding ring distance (35.0–41.0 vs. 32.5 μm), and lower a ratio (68.7–87.8 vs. 80.0–107 μm).

From L. ferrisi, it differs by a longer body (5.6–7.7 vs. 4.3–5.9 mm), different amphidial fovea shape (pouch-like, not bilobed vs. symmetrically bilobed at base), and longer spicule length (68.0–80.0 vs. 53.0–63 μm). From L. kheirii, it differs by having a smaller body (5.6–7.7 vs. 6.7–9.0 mm), smaller odontostyle and odontophore (102–115 vs. 113–130 μm and 47.0–75.0 vs. 69.0–97.5), narrower lip region width (16.5–18.5 vs. 19.5–23.0 μm), smaller tail (39.0–50.0 vs. 47.0–72.0 μm), and smaller spicule length (68.0–80.0 vs. 85.0 μm). From L. pauli, it differs by a smaller body [average 6.7 (5.6–7.7) vs. average 7.6 (6.5–8.6 mm)], different amphidial fovea shape (pouch-like, not bilobed vs. asymmetrically bilobed at base), wider lip region width (16.5–18.5 vs. 13.9–16.8 μm), lower a ratio (68.7–87.8 vs. 120.3–143.5), higher oral aperture to guiding ring distance (35.0–41.0 vs. 27.2–35.8 μm), longer spicule length (68.0–80.0 vs. 61.0–69 μm), and a lower number of ventromedian supplements in the male tail (8–14 vs. 12–16). From L. proximus, it differs by a lip region shape (continuous vs. expanded, high, separated from the rest of body by a depression), lower a and c ratio (68.7–87.8 vs.104–138 and 122.4–189.4 vs. 165–249), and position of pharyngeal gland nuclei (normal vs. more posterior). It differs from L. soosanae by having an anterior body region shape (uniformly narrowing towards anterior end vs. bottle-shaped), longer odontostyle (102–115 vs. 92.0–103 μm), lower a ratio (68.7–87.8 vs. 79–114), longer tail (39–50 vs. 33–42 μm), and longer spicule length (68.0–80.0 vs. 50.0–64 μm). From L. hyrcanus, it differs by a longer body (5.6–7.7 vs. 5.0–5.8 mm), different shaped lip region (anteriorly flattened, continuous with the adjacent body vs. rounded, continuous with body contour), different amphidial fovea shape (not bilobed vs. asymmetrically bilobed at base), wider lip region width (16.5–18.5 vs. 11.5–14.0 μm), longer spicule length (68.0–80.0 vs. 55.0–68 μm), different tail shape in J1 (slender conical, without a digitate or subdigitate terminus vs. slender, with broadly rounded tail end), and shorter tail of J1 (43.0–50.0 vs. 24.0 μm). Finally, from L. elongatus, the new species differs mainly by having a longer body (5.6–7.7 vs. 4.5–6.4 mm), different amphidial fovea shape (pouch-like, not bilobed vs. asymmetrically bilobed at base), longer odontostyle (102–115 vs. 81.0–102 μm), and higher oral aperture to guiding ring distance (35.0–41.0 vs. 29.0–36.0 μm).

Etymology

The specific epithet refers to the province of Zanjan, north-western Iran where the new species was collected.

Type host and locality

The type population was collected from the rhizosphere of Astragalus sp. naturally growing in mountains of Anguran Protected Area, West Mahneshan, Zanjan province, north-western Iran, coordinates: 36º 51’ 9.5416’’ N; 47º 45’ 1.2196’ ’E; altitude: 1350 m a. s. l.

Type material

Holotype female (slide: 1412-b5), five female paratypes, 11 male paratypes, and 57 juvenile paratypes (slides: 1412-b1-16) were deposited in the nematode collection at the Faculty of Agriculture, University of Zanjan, Zanjan, Iran. Four female paratypes and four male paratypes were deposited in the nematode collection at the Institute for Sustainable Agriculture (IAS), Spanish National Research Council (CSIC), Cordoba, Spain (IAS_L_2023-2_Ir).

The Life Science Idenitifier (LSID) for the publication is: urn:lsid:zoobank.org:pub:E071D8F1- E494-4D1F-9DDF-782D6BDD3CCF.

Molecular characterisation and phylogenetic position of Longidorus zanjanensis sp. nov.

The amplification of D2-D3 segments of 28S rRNA and ITS1 yielded single fragments of ca. 900 bp, and 1100 bp, respectively, based on gel electrophoresis. Four identical sequences were obtained for D2-D3 segments of 28S rRNA with 97.3% (22 nucleotides difference), 96.9% (23 nucleotides difference), and 96.4% (27 nucleotides difference) similarity with L. soosanae (ON122993), L. hyrcanus (OL739253-OL739254), and several sequences of L. elongatus (MN123751), respectively. Four ITS1 region sequences with only one nucleotide difference in one sequence were obtained. Similarly to the D2-D3 region, the ITS1 region is similar to L. soosanae (ON121993-ON121994), L. hyrcanus (OL684817), and several sequences of L. elongatus (AF511417), at 87.0–88.5%, 89.2%, and 85.5%, respectively.

Phylogenetic relationships among Longidorus species inferred from analyses of D2-D3 expansion segments of 28S rRNA and ITS1 sequences using BI are given in Figures 5 and 6, respectively. The D2-D3 expansion segments of the 28S rRNA tree of Longidorus spp. are based on a multiple edited alignment including 121 sequences and 760 total characters, revealing four major clades, three of them highly supported (PP = 1.00) and the other with moderate support (PP = 0.97) (Figure 5). Longidorus zanjanensis sp. nov. (OR509844-OR509847) and L. hyrcanus (OL739254) clustered in a moderately supported clade (PP = 0.96). These two species are related to L. intermedius Kozlowska & Seinhorst, Reference Kozlowska and Seinhorst1979 (AY593058), L. elongatus (AF480078), and L. soosanae (ON122993) in a relatively well-supported clade (PP = 0.98); they are related in another relatively well-supported clade (PP = 0.96) to L. carpathicus Lišková et al., Reference Lišková, Robbins and Brown1997 (AF480072), L. uroshis Krnjaić et al., Reference Krnjaić, Lamberti, Krnjaić, Agostinelli and Radicci2000 (EF538754), L. piceicola Lišková, et al., Reference Lišková, Robbins and Brown1997 (KY086070), and L. artemisiae (KX137849). These species from both clades are related in a highly supported clade (PP = 1.00).

Figure 5. Phylogenetic relationships of Longidorus zanjanensis sp. nov. within the genus Longidorus. Bayesian 50% majority rule consensus tree as inferred from D2 and D3 expansion domains of 28S rRNA sequence alignment under the general time-reversible model of sequence evolution with correction for invariable sites and a gamma-shaped distribution (GTR + I+ G). Posterior probabilities more than 0.70 are given for appropriate clades. Newly obtained sequences in this study are shown in boldface type, and coloured box indicates clade association of the new species. Scale bar = expected changes per site.

Figure 6. Phylogenetic relationships of Longidorus zanjanensis sp. nov. within the genus Longidorus. Bayesian 50% majority rule consensus tree as inferred from ITS1 region sequence alignment under the GTR + G model. Posterior probabilities more than 0.70 are given for appropriate clades. Newly obtained sequences in this study are shown in boldface type, and coloured box indicates clade association of the new species. Scale bar = expected changes per site.

For the ITS1 region sequences, the 50% majority rule consensus BI tree of a multiple sequence alignment containing 12 sequences and 928 characters is showed in Figure 6. Longidorus zanjanensis sp. nov. (OR509848-OR509851) clustered with L. soosanae (ON121994) in a low supported clade (PP = 0.83). These two species clustered with L. hyrcanus in a highly supported clade (PP = 0.99). Additionally, L. elongatus (AF511417) is closely related to these three species in a low-supported clade (PP = 0.90) sp. nov. These species are related with L. piceicola (LT669803) and L. intermedius (KT308890) in a highly supported clade (PP = 1.00).

This new species increases the knowledge of the biodiversity of this genus in Iran, including molecular markers for its unequivocal identification. Other species from Iran are closely related to our species (L. soosane and L. hyrcanus), but clearly separated using our integrative taxonomy. This species is clearly described using an integrative taxonomical approach (combination of morphology-morphometry and molecular data). The high diversity of this genus in Iran points to this region as a high diversity location for this group of nematodes.

Acknowledgements

The authors thank Mrs. C. Cantalapiedra-Navarrete (IAS-CSIC) for helping with molecular analyses, and anonymous reviewers and editors for their efforts in reviewing the manuscript and helping improve this study.

Financial support

There are not projects associated with this research.

Competing interest

None.

Ethical standard

The authors assert that all procedures contributing to this work comply with the ethical standards of the relevant national and institutional guides on the care and use of laboratory animals.

References

Andrássy, I (2009). Free-living nematodes of Hungary (Nematoda errantia) , Volume III. Budapest: Hungarian Natural History Museum and Systematic Zoology Research Group of the Hungarian Academy of Sciences, 608p.Google Scholar
Bakhshi Amrei, S, Peneva, V, Rakhshandehroo, F, Pedram, M (2020). Morphological and molecular description of Longidorus behshahrensis sp. n. (Nematoda: Longidoridae) from natural forests of Abbas Abad, north of Iran. European Journal of Plant Pathology 156, 1, 387–398. https://doi.org/10.1007/s10658-019-01884-yCrossRefGoogle Scholar
Bakhshi Amrei, S, Peneva, V, Rakhshandehroo, F, Pedram, M (2022). Description of Longidorus armeniacae n. sp. (Nematoda: Longidoridae), associated with Prunus armeniaca L. in Semnan province, Iran. European Journal of Plant Pathology 162, 1, 739–750. https://doi.org/10.1007/s10658-021-02435-0CrossRefGoogle Scholar
Archidona-Yuste, A, Navas-Cortés, JA, Cantalapiedra-Navarrete, C, Palomares-Rius, JE, Castillo, P (2016a). Remarkable diversity and prevalence of dagger nematodes of the genus Xiphinema Cobb, 1913 (Nematoda: Longidoridae) in olives revealed by integrative approaches. PLoS ONE 11, 11, e0165412. https://doi.org/10.1371/journal.pone.0165412CrossRefGoogle ScholarPubMed
Archidona-Yuste, A, Navas-Cortés, JA, Cantalapiedra-Navarrete, C, Palomares-Rius, JE, Castillo, P (2016b). Unravelling the biodiversity and molecular phylogeny of needle nematodes of the genus Longidorus (Nematoda: Longidoridae) in olive and a description of six new species. PLoS ONE 11, 1, e0147689. https://doi.org/10.1371/journal.pone.0147689CrossRefGoogle Scholar
Archidona-Yuste, A, Navas-Cortés, JA, Cantalapiedra-Navarrete, C, Palomares-Rius, JE, Castillo, P (2016c). Cryptic diversity and species delimitation in the Xiphinema americanum-group complex (Nematoda: Longidoridae) as inferred from morphometrics and molecular markers. Zoological Journal of the Linnean Society 176, 2, 231–265. https://doi.org/10.1111/zoj.12316CrossRefGoogle Scholar
Archidona-Yuste, A, Navas-Cortés, JA, Cantalapiedra-Navarrete, C, Palomares-Rius, JE, Castillo, P (2016d). Molecular phylogenetic analysis and comparative morphology resolve two new species of olive-tree soil related dagger nematodes of the genus Xiphinema (Dorylaimida: Longidoridae) from Spain. Invertebrate Systematics 30, 6, 547–565. https://doi.org/10.1071/IS16002CrossRefGoogle Scholar
Archidona-Yuste, A, Wiegand, T, Castillo, P, Navas-Cortés, JA (2019a). Dataset on the diversity of plant-parasitic nematodes in cultivated olive trees in southern Spain. Data in Brief 27, 104658. https://doi.org/10.1016/j.dib.2019.104658CrossRefGoogle ScholarPubMed
Archidona-Yuste, A, Cantalapiedra-Navarrete, C, Castillo, P, Palomares-Rius, JE (2019b). Molecular phylogenetic analysis and comparative morphology reveals the diversity and distribution of needle nematodes of the genus Longidorus (Dorylaimida: Longidoridae) from Spain. Contributions to Zoology 88, 1–41. https://doi.org/10.1163/18759866-20191345CrossRefGoogle Scholar
Asgari, M, Eskandari, A, Castillo, P, Palomares-Rius, JE (2022). Morphological and molecular characterisation of Longidorus sabalanicus n. sp. (Nematoda: Longidoridae) from Iran. European Journal of Plant Pathology 163, 1, 19–34. https://doi.org/10.1007/s10658-021-02454-xCrossRefGoogle Scholar
Brown, DJF, Lamberti, F, Taylor, CE, Trudgill, DL (1988). Nematode-virus plant interactions. Nematologia Mediterranea 16, 2, 153–158.Google Scholar
Brown, DJF, Grunder, J, Hooper, DJ, Klingler, J, Kunz, P (1994). Longidorus arthensis sp. n. (Nematoda: Longidoridae) a vector of cherry rosette disease caused by a new nepovirus in cherry trees in Switzerland. Nematologica 40, 1–4, 133–149. https://doi.org/10.1163/003525994X00094CrossRefGoogle Scholar
Cai, R, Archidona-Yuste, A, Cantalapiedra-Navarrete, C, Palomares-Rius, JE, Castillo, P (2020a). Integrative descriptions and molecular phylogeny of two new needle nematodes of the genus Longidorus (Nematoda: Longidoridae) from Spain. European Journal of Plant Pathology 156, 1, 67–86. https://doi.org/10.1007/s10658-019-01862-4CrossRefGoogle Scholar
Cai, R, Prior, T, Lawson, B, Cantalapiedra-Navarrete, C, Palomares-Rius, JE, Castillo, P, Archidona-Yuste, A (2020b). An integrative taxonomic study of the needle nematode complex Longidorus goodeyi Hooper, 1961 (Nematoda: Longidoridae) with description of a new species. European Journal of Plant Pathology 158, 1, 59–81. https://doi.org/10.1007/s10658-020-02055-0CrossRefGoogle Scholar
Chen, QW, Hooper, DJ, Loof, PAA, Xu, J (1997). A revised polytomous key for the identification of species of the genus Longidorus Micoletzky, 1922 (Nematoda: Dorylaimoidea). Fundamental and Applied Nematology 20, 1, 15–28.Google Scholar
Cherry, T, Szalanski, AL, Todd, TC, Powers, TO (1997). The internal transcribed spacer region of Belonolaimus (Nemata: Belonolaimidae). Journal of Nematology 29, 1, 23–29.Google ScholarPubMed
Clavero-Camacho, I, Liébanas, G, Escuer, M, Cantalapiedra-Navarrete, C, Archidona-Yuste, A, Castillo, P, Palomares-Rius, JE (2021). Studies on Longidorus iberis (Escuer & Arias, 1997) n. comb. (Nematoda: Longidoridae) from Spain. Nematology 23, 8, 871–885. https://doi.org/ 10.1163/15685411-bja10082.CrossRefGoogle Scholar
Coolen, WA (1979). Methods for extraction of Meloidogyne spp. and other nematodes from roots and soil. In Lamberti, F, Taylor, CE (eds), Root-knot Nematodes (Meloidogyne species). Systematics, Biology and Control. New York: Academic Press, 317–329.Google Scholar
Coomans, A (1996). Phylogeny of the Longidoridae. Russian Journal of Nematology 4, 1, 51–60.Google Scholar
Coomans, A, Huys, R, Heyns, J, Luc, M (2001). Character analysis, phylogeny, and biogeography of the genus Xiphinema Cobb, 1913 (Nematoda, Longidoridae). Annales Sciences Zoologiques, Musée Royal de l’Afrique Centrale, Tervuren, Belgique 287, 1–239.Google Scholar
Darriba, D, Taboada, GL, Doallo, R, Posada, D (2012). jModelTest 2: more models, new heuristics and parallel computing. Nature Methods 9, 8, 772. https://doi.org/10.1038/nmeth.2109CrossRefGoogle ScholarPubMed
Decraemer, W, Robbins, RT (2007). The who, what and where of Longidoridae and Trichodoridae. Journal of Nematology 39, 4, 295–297.Google ScholarPubMed
Decraemer, W, Geaert, E (2013). Ectoparasitic nematodes. In Perry, R, Moens, M (eds), Plant Nematology, 2nd Edition. Wallingford, UK: CABI, 179–214.CrossRefGoogle Scholar
De Grisse, A (1969). Redescription ou modifications de quelques techniques utililisées dans l’étude des nematodes phytoparasitaires. Mededelingen van de Rijksfaculteit Landbouwwetenschappen Gent 34, 351–369.Google Scholar
De Luca, F, Reyes, A, Grunder, J, Kunz, P, Agostinelli, A, De Giorgi, C, Lamberti, F (2004). Characterization and sequence variation in the rDNA region of six nematode species of the genus Longidorus (Nematoda). Journal of Nematology 36, 2, 147–152.Google ScholarPubMed
De Man, JG (1876). Onderzoekingen over vrij in de aarde levende nematoden. Tijdschrift Der Nederlandsche Dierkundige Vereeniging 2, 78–196.Google Scholar
Edward, JC, Misra, SL, Singh, GR (1964). Longidorus pisi n. sp. (Nematoda, Dorylaimoidea) associated with the rhizosphere of Pisum sativum, from Uttar Pradesh, India. Japanese Journal of Applied Entomology and Zoology 8, 310–312. https://doi.org/10.1303/jjaez.8.310CrossRefGoogle Scholar
Esmaeili, M, Heydari, R, Archidona-Yuste, A, Castillo, P, Palomares-Rius, JE (2017). A new needle nematode, Longidorus persicus n. sp. (Nematoda: Longidoridae), from Kermanshah province, western Iran. European Journal of Plant Pathology 147, 1, 27–41. https://doi.org/10.1007/s10658-016-0976-9CrossRefGoogle Scholar
Eveleigh, ES, Allen, WR (1982). Description of Longidorus diadecturus n. sp. (Nematoda: Longidoridae), a vector of the peach rosette mosaic virus in peach orchards in southwestern Ontario, Canada. Canadian Journal of Zoology 60, 2, 112–115. https://doi.org/10.1139/z82-014.CrossRefGoogle Scholar
Flegg, JJM (1967). Extraction of Xiphinema and Longidorus species from soil by a modification of Cobb’s decanting and sieving technique. Annals of Applied Biology 60, 3, 429–437. https://doi.org/10.1111/j.1744-7348.1967.tb04497.xCrossRefGoogle Scholar
Gutiérrez-Gutiérrez, C, Cantalapiedra-Navarrete, C, Montes-Borrego, M, Palomares-Rius, JE, Castillo, P (2013). Molecular phylogeny of the nematode genus Longidorus (Nematoda: Longidoridae) with description of three new species. Zoological Journal of the Linnean Society 167, 4, 473–500. https://doi.org/10.1111/zoj.12019CrossRefGoogle Scholar
Gutiérrez-Gutiérrez, C, Teixeira Santos, M, Inácio, ML, Eisenback, JD, Mota, M (2020). Description of Longidorus bordonensis sp. nov. from Portugal, with systematics and molecular phylogeny of the genus (Nematoda, Longidoridae). Zoosystematics and Evolution 96, 1, 175–193. https://doi.org/10.3897/zse.96.49022CrossRefGoogle Scholar
Hall, TA (1999). BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series 41, 95–98.Google Scholar
He, Y, Subbotin, SA, Rubtsova, TV, Lamberti, F, Brown, DJF, Moens, M (2005). A molecular phylogenetic approach to Longidoridae (Nematoda: Dorylaimida). Nematology 7, 1, 111–124. https://doi.org/10.1163/1568541054192108CrossRefGoogle Scholar
Holterman, M, van der Wurff, A, van den Elsen, S, van Megen, H, Bongers, T, Holovachov, O, Bakker, J, Helder, J (2006). Phylum-wide analysis of SSU rDNA reveals deep phylogenetic relationships among nematodes and accelerated evolution toward crown clades. Molecular Biology and Evolution 23, 9, 1792–1800. https://doi.org/10.1093/molbev/msl044CrossRefGoogle ScholarPubMed
Hooper, DJ (1961). A redescription of Longidorus elongatus (de Man, 1876) Thorne & Swanger, 1936 (Nematoda, Dorylaimidae) and descriptions of five new species of Longidorus from Great Britain. Nematologica 6, 3, 237–257. https://doi.org/10.1163/187529261X00072CrossRefGoogle Scholar
Hooper, DJ (1966). Longidorus profundorum n. sp. (Nematoda: Dorylaimidae). Nematologica 11, 4, 489–495. https://doi.org/10.1163/187529265X00672CrossRefGoogle Scholar
Janssen, J, Karssen, G, Orlando, V, Subbotin, SA, Bert, W (2017). Molecular characterization and species delimiting of plant-parasitic nematodes of the genus Pratylenchus from the penetrans group (Nematoda: Pratylenchidae). Molecular Phylogenetics and Evolution 117, 30–48. https://doi.org/10.1016/j.ympev.2017.07.027CrossRefGoogle ScholarPubMed
Jairajpuri, MS. Ahmad, W (1992). Dorylaimida: Free-living, Predaceous and Plant-Parasitic Nematodes. New Delhi: Oxford and IBH Publishing Co. Pvt. Ltd.CrossRefGoogle Scholar
Katoh, K, Rozewicki, J, Yamada, KD (2019). MAFFT online service: multiple sequence alignment, interactive sequence choice and visualization. Briefings in Bioinformatics 20, 4, 1160–1166. https://doi.org/10.1093/bib/bbx108CrossRefGoogle ScholarPubMed
Kozlowska, J, Seinhorst, JW (1979). Longidorus elongatus and closely related species in The Netherlands and Lower Saxony (Germany), with the description of two new species, L. cylindricaudatus and L. intermedius (Nematoda: Dorylaimida). Nematologica 25, 1, 42–53. https://doi.org/10.1163/187529279X00361CrossRefGoogle Scholar
Krnjaić, D, Lamberti, F, Krnjaić, S, Agostinelli, A, Radicci, V (2000). Three new longidorids (Nematoda: Dorylaimida) from Montenegro. Nematologia Mediterranea 28, 2, 235–248.Google Scholar
Lamberti, F, Bleve-Zacheo, T (1977). Two new species of Longidorus (Nematoda: Longidoridae) from Italy. Nematologia Mediterranea 5, 1, 73–83.Google Scholar
Lamberti, F, Molinari, S, De Luca, F, Agostinelli, A, Di Vito, M (1999). Longidorids (Nematoda, Dorylaimida) from Syria with description of Longidorus pauli sp. n. and Paralongidorus halepensis sp. n. with SOD isozymes and PCR-RFLP profiles. Nematologia Mediterranea 27, 1, 63–78.Google Scholar
Lišková, M, Robbins, RT, Brown, DJF (1997). Descriptions of three new Longidorus species from Slovakia (Nemata: Longidoridae). Journal of Nematology 29, 3, 336–348.Google ScholarPubMed
Loof, PAA (1982). Two new species of Longidoridae (Dorylaimida) from Saudi Arabia. Nematologica 28, 3, 307–317. https://doi.org/10.1163/187529282X00358CrossRefGoogle Scholar
Loof, PAA, Coomans, A (1972). The oesophageal gland nuclei of Longidoridae (Dorylaimida). Nematologica 18, 2, 213–233. https://doi.org/10.1163/187529272X00458CrossRefGoogle Scholar
Loof, PAA, Chen, QW (1999) A revised polytomous key for the identification of species of the genus Longidorus Micoletzky, 1922 (Nematoda: Dorylaimoidea). Supplement 1. Nematology 1, 1, 55–59. https://doi.org/10.1163/156854199507974CrossRefGoogle Scholar
Macfarlane, SA (2003). Molecular determinants of the transmission of plant viruses by nematodes. Molecular Plant Pathology 4, 3, 211–215. https://doi.org/10.1046/j.1364-3703.2003.00164.xCrossRefGoogle ScholarPubMed
Mali, VR, Hooper, DJ (1974). Observations on Longidorus euonymus n. sp. and Xiphinema vuittenezi Luc et al 1964 (Nematoda: Dorylaimida) associated with spindle trees infected with euonymus mosaic virus in Czechoslovakia. Nematologica 19, 4, 459–467. https://doi.org/10.1163/187529273X00457CrossRefGoogle Scholar
Merny, G (1966). Nématodes d’Afrique tropicale: un nouveau Paratylenchus (Criconematidae), deux nouveaux Longidorus et observations sur Longidorus Laevicapitatus Williams, 1959 (Dorylaimidae). Nematologica 12, 3, 385–395. https://doi.org/10.1163/187529266X00860CrossRefGoogle Scholar
Micoletzky, H (1922). Die freilebenden Erd-Nematoden mit besonderer Berucksichtigung der Steiermark und der Bukowina, zugleich mit einer Revision sämtlicher, nicht mariner, freilebender Nematoden in Form von Genus-Beschreibungen und Bestimmungsschlüsseln. Archiv für Naturgeschichte 87A, 1–650.Google Scholar
Mobasseri, M, Pourjam, E, Farashiani, ME, Pedram, M (2023). Morpho-molecular characterization of a new nematode species of the genus Longidorus Micoletzky, 1922 (Nematoda: Longidoridae) from northern Iran. European Journal of Plant Pathology 165, 1, 241–254. https://doi.org/10.1007/s10658-022-02603-wCrossRefGoogle Scholar
Niknam, G, Pedram, M, Ghahremani Nejad, E, Ye, W, Robbins, RT, Tanha Maafi, Z (2010). Morphological and molecular characterization of Longidorus tabrizicus sp. n. and L. sturhani Rubtsova, Subbotin, Brown & Moens, 2001 (Nematoda: Longidoridae) from north-western Iran. Russian Journal of Nematology 18, 2, 127–140.Google Scholar
Nunn, GB (1992). Nematode Molecular Evolution. An Investigation of Evolutionary Patterns among Nematodes Based upon DNA Sequences. Ph.D. Thesis, University of Nottingham: Nottingham, UK.Google Scholar
Palomares-Rius, JE, Cantalapiedra-Navarrete, C, Castillo, P (2014). Cryptic species in plant-parasitic nematodes. Nematology 16, 10, 1105–1118. https://doi.org/10.1163/15685411-00002831CrossRefGoogle Scholar
Palomares-Rius, JE, Escobar, C, Cabrera, J, Vovlas, A, Castillo, P (2017). Anatomical alterations in plant tissues induced by plant-parasitic nematodes. Frontiers in Plant Science 8, 1987. https://doi.org/10.3389/fpls.2017.01987CrossRefGoogle ScholarPubMed
Palomares-Rius, JE, Subbotin, SA, Landa, BB, Vovlas, N, Castillo, P (2008). Description and molecular characterisation of Paralongidorus litoralis sp. n. and P. paramaximus Heyns, 1965 (Nematoda: Longidoridae) from Spain. Nematology 10, 1, 87–101. https://doi.org/10.1163/156854108783360186CrossRefGoogle Scholar
Pearse, AS (1942). Introduction to Parasitology, 1st edn. Springfield-Baltimore: Charles C. Thomas Company.CrossRefGoogle Scholar
Pedram, M, Niknam, G, Robbins, RT, Ye, W, Karegar, A (2008). Longidorus kheirii n. sp. (Nematoda: Longidoridae) from Iran. Systematic Parasitology 71, 3, 199–211. https://doi.org/10.1007/s11230-008-9148-4CrossRefGoogle Scholar
Peneva, VK, Lazarova, SS, De Luca, F, Brown, DJF (2013). Description of Longidorus cholevae sp. n. (Nematoda, Dorylaimida) from a riparian habitat in the Rila Mountains, Bulgaria. ZooKeys 330, 1–26. https://doi.org/10.3897/zookeys.330.5750CrossRefGoogle Scholar
Pour Ehtesham, N, Pedram, M, Atighi, MR, Jahanshahi Afshar, F (2023). Morphological and molecular phylogenetic study of Longidorus soosanae n. sp. (Nematoda: Longidoridae) from Golestan province, northern Iran. European Journal of Plant Pathology 166, 2, 227–239. https://doi.org/10.1007/s10658-023-02657-4CrossRefGoogle Scholar
Rambaut, A (2018). FigTree v1.4.4, a Graphical Viewer of Phylogenetic Trees. Available online: http://tree.bio.ed.ac.uk/software/figtree/ (accessed on 27 July 2023).Google Scholar
Robbins, RT, Brown, DJF, Halbrendt, JM, Vrain, TC (1995). Compendium of Longidorus juvenile stages with observations on L. pisi, L. taniwha, and L. diadecturus (Nematoda: Longidoridae). Systematic Parasitology 32, 1, 33–52. https://doi.org/10.1007/BF00009466CrossRefGoogle Scholar
Robbins, RT, Ye, W, Pedram, M (2009). Longidorus ferrisi n. sp. from California Citrus. Journal of Nematology 41, 2, 104–110.Google Scholar
Roca, F, Lamberti, F (1981). Longidorus fasciatus sp. n. from Greece and Italy. Nematologia Mediterranea 9, 2, 175–179.Google Scholar
Roca, F, Lamberti, F, Agostinelli, A, Vinciguerra, MT (1986). Longidorus aetnaeus, a new Longidoridae species from Italy. Nematologia Mediterranea 14, 1, 1–5.Google Scholar
Ronquist, F, Huelsenbeck, JP (2003). MRBAYES 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19, 12, 1572–1574. https://doi.org/10.1093/bioinformatics/btg180CrossRefGoogle ScholarPubMed
Roshan-Bakhsh, A, Pourjam, E, Pedram, M (2016). Description of Longidorus perangustus sp. n. (Dorylaimida: Longidoridae), an amphimictic species from Iran. European Journal of Plant Pathology 144, 3, 581–594. https://doi.org/10.1007/s10658-015-0796-3CrossRefGoogle Scholar
Rubtsova, TV, Chizhov, VN, Subbotin, SA (1999). Longidorus artemisiae sp. n. (Nematoda: Longidoridae) from roots of Artemisia sp., Rostov region, Russia. Russian Journal of Nematology 7, 1, 33–38.Google Scholar
Rubtsova, TV, Subbotin, SA, Brown, DJF, Moens, M (2001). Description of Longidorus sturhani sp. n (Nematoda: Longidoridae) and molecular characterization of several longidorid species from Western Europe. Russian Journal of Nematology 9, 2, 127–136.Google Scholar
Sturhan, D, Argo, D (1983). Studies on Longidorus closelongatus Stoyanov and L. cohni Heyns, with description of L. proximus sp. nov. (Nematoda, Dorylaimida). Revue de Nématologie 6, 1, 57–64.Google Scholar
Sturhan, D, Barooti, S (1983). Longidorus iranicus n. sp. (Nematoda: Dorylaimida). Systematic Parasitology 5, 1, 21–24. https://doi.org/10.1007/BF00010982CrossRefGoogle Scholar
Sturhan, D, Weischer, B (1964). Longidorus vineacola n. sp. (Nematoda: Dorylaimidae). Nematologica 10, 2, 335–341. https://doi.org/10.1163/187529264X00114Google Scholar
Subbotin, SA, Halford, PD, Warry, A, Perry, RN (2000). Variations in ribosomal DNA sequences and phylogeny of Globodera parasitising solanaceous plants. Nematology 2, 6, 591–604. https://doi.org/10.1163/156854100509484CrossRefGoogle Scholar
Tan, G, Muffato, M, Ledergerber, C, Herrero, J, Goldman, N, Gil, M, Dessimoz, C (2015). Current methods for automated filtering of multiple sequence alignments frequently worsen single-gene phylogenetic inference. Systematic Biology 64, 5, 778–791. https://doi.org/10.1093/sysbio/syv033CrossRefGoogle ScholarPubMed
Taylor, CE, Brown, DJF (1997). Nematode Vectors of Plant Viruses. 1st edn. Wallingford: CAB International.Google Scholar
Thorne, G (1935). Notes on free-living and plant-parasitic nematodes, II. Proceedings of the Helminthological Society of Washington 2, 96–98.Google Scholar
Thorne, G (1974). Nematodes of the northern great plains. Part II. Dorylaimoidea in part (Nemata: Adenophorea). Agricultural Experiment Station Technical Bulletins 41, 1–120.Google Scholar
Thorne, G, Swanger, HH (1936). A monograph of the nematode genera Dorylaimus Dujardin, Aporcelaimus n. g., Dorylaimoides n. g. and Pugentus n. g. Capita Zoologica 6, 1–223.Google Scholar
Vrain, TC, Wakarchuk, DA, Levesque, AC, Hamilton, RI (1992). Intraspecific rDNA restriction fragment length polymorphism in the Xiphinema americanum group. Fundamental and Applied Nematology 15, 6, 563–573.Google Scholar
Whitehead, AF, Hemming, JR (1965). A comparison of some quantitative methods of extracting small vermiform nematodes from soil. Annals of Applied Biology 55, 1, 25–38. https://doi.org/10.1111/j.1744-7348.1965.tb07864.xCrossRefGoogle Scholar
Ye, W, Robbins, RT (2003). Longidorus paravineacola n. sp. (Nematoda: Longidoridae), a new species from Arkansas. Journal of Nematology 35, 4, 388–394.Google Scholar
Figure 0

Figure 1. Line drawings of Longidorus zanjanensis sp. nov. A: Female reproductive system. B: Female anterior region. C: Female anterior region. D: Anterior end showing amphidial fovea. E, F: Female tail. G: Male posterior body region. H: J1 tail. I: J2 tail. J: J3 tail. K: J4 tail.

Figure 1

Table 1. Morphometrics of Longidorus zanjanensis sp. nov. from Zanjan, Iran. All measurements are in μm (except L, in mm) and in the form: mean ± standard deviation (range)

Figure 2

Figure 2. Light micrographs of Longidorus zanjanensis sp. nov. (a–d) female anterior body regions showing odontostyle, odontophore, amphidial fovea, and guiding ring (arrowed); (e) detail of basal bulb showing dorsal gland and ventrosublateral nuclei (arrowed); (f-i) female tail; (j, k) male tail with details of spicules, guiding pieces of gubernaculum and ventromedian supplements (arrowed). Abbreviations: a = anus; af = amphidial fovea; gr = guiding ring; gp = guiding pieces of gubernaculum; odt = odontostyle; odp = odontophore; sp = spicule; vspl = ventromedian supplement. (Scale bars: 20 μm).

Figure 3

Figure 3. Light micrographs of Longidorus zanjanensis sp. nov. (a–d) tails of J1, J2, J3, and J4. (Scale bars: a–d = 20 μm).

Figure 4

Figure 4. Relationship between body length and functional and replacement odontostyle length in all developmental juvenile life stages and mature adults of Longidorus zanjanensis sp. nov.

Figure 5

Figure 5. Phylogenetic relationships of Longidorus zanjanensis sp. nov. within the genus Longidorus. Bayesian 50% majority rule consensus tree as inferred from D2 and D3 expansion domains of 28S rRNA sequence alignment under the general time-reversible model of sequence evolution with correction for invariable sites and a gamma-shaped distribution (GTR + I+ G). Posterior probabilities more than 0.70 are given for appropriate clades. Newly obtained sequences in this study are shown in boldface type, and coloured box indicates clade association of the new species. Scale bar = expected changes per site.

Figure 6

Figure 6. Phylogenetic relationships of Longidorus zanjanensis sp. nov. within the genus Longidorus. Bayesian 50% majority rule consensus tree as inferred from ITS1 region sequence alignment under the GTR + G model. Posterior probabilities more than 0.70 are given for appropriate clades. Newly obtained sequences in this study are shown in boldface type, and coloured box indicates clade association of the new species. Scale bar = expected changes per site.